Mutagenetix > Incidental Mutations

Incidental Mutation 'R4234:Casp8'

320991

Institutional Source

Beutler Lab

Gene Symbol

Casp8

Ensembl Gene

ENSMUSG00000026029

Gene Name

caspase 8

Synonyms

MACH, Mch5, FLICE, Caspase-8

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4234 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

58795374-58847503 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58844770 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 432 (V432A)

Ref Sequence

ENSEMBL: ENSMUSP00000140546 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027189] [ENSMUST00000165549] [ENSMUST00000190213] [ENSMUST00000191201]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027189
AA Change: V412A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027189
Gene: ENSMUSG00000026029
AA Change: V412A

Domain	Start	End	E-Value	Type
DED	1	80	3.21e-23	SMART
DED	99	178	1.01e-15	SMART
CASc	227	480	2.13e-110	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000165549
AA Change: V412A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127375
Gene: ENSMUSG00000026029
AA Change: V412A

Domain	Start	End	E-Value	Type
DED	1	80	3.21e-23	SMART
DED	99	178	1.01e-15	SMART
CASc	227	480	2.13e-110	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000190213
AA Change: V432A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140335
Gene: ENSMUSG00000026029
AA Change: V432A

Domain	Start	End	E-Value	Type
DED	21	100	1.5e-25	SMART
DED	119	198	5e-18	SMART
CASc	247	500	1.1e-112	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000191201
AA Change: V432A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140546
Gene: ENSMUSG00000026029
AA Change: V432A

Domain	Start	End	E-Value	Type
DED	21	100	1.5e-25	SMART
DED	119	198	5e-18	SMART
CASc	247	500	1.1e-112	SMART

Meta Mutation Damage Score

0.9261

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene is part of a family of caspases, aspartate-specific cysteine proteases well studied for their involvement in immune and apoptosis signaling. This protein, an initiator of apoptotic cell death, is activated by death-inducing tumor necrosis family receptors and targets downstream effectors. In mouse deficiency of this gene can cause embryonic lethality. This protein may have a role in embryogenesis. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired cardiac muscle development, cardiac erythrocyte congestion, low numbers of colony-forming cells, and prenatal lethality. T-cell restricted knockout mice are viable, but immunodeficient. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
Ahnak	A	T	19: 9,000,786	K90*	probably null	Het
Ajuba	T	C	14: 54,569,526	R490G	probably damaging	Het
Akap6	T	A	12: 53,139,671	N1289K	probably damaging	Het
Ankfy1	G	A	11: 72,714,484		probably null	Het
Ap3s1	A	T	18: 46,779,200	T96S	probably benign	Het
Arhgap21	A	G	2: 20,887,137	V161A	probably damaging	Het
Arhgef18	T	C	8: 3,450,317	I541T	possibly damaging	Het
Aspg	T	A	12: 112,123,316	Y429*	probably null	Het
Atg14	T	C	14: 47,551,345	K184E	probably benign	Het
BC034090	C	T	1: 155,241,580	G264D	probably benign	Het
Cerk	T	C	15: 86,142,788	K174E	probably benign	Het
Col19a1	T	C	1: 24,315,395		probably null	Het
Cyp2c23	G	T	19: 44,029,165	T8K	unknown	Het
Ddx1	C	T	12: 13,223,857	V590I	possibly damaging	Het
Dok4	T	C	8: 94,865,664	E232G	probably damaging	Het
Dpf1	T	C	7: 29,315,632	S304P	probably damaging	Het
Dpyd	T	A	3: 119,431,584	I1002N	probably damaging	Het
Fam107b	T	C	2: 3,770,740	S3P	possibly damaging	Het
Gm1527	G	A	3: 28,914,366	G189D	probably damaging	Het
Hspa12b	T	C	2: 131,139,012	V162A	probably benign	Het
Lix1l	T	A	3: 96,623,657		probably null	Het
Mdc1	T	C	17: 35,848,824	C658R	probably benign	Het
Mrps30	T	C	13: 118,386,840	D132G	probably damaging	Het
Myh15	G	T	16: 49,163,042	V1507L	probably benign	Het
Nfe2l1	T	C	11: 96,819,909	D210G	probably damaging	Het
Notch3	T	A	17: 32,141,341	I1539F	probably damaging	Het
Pcdhac1	A	C	18: 37,090,958	S275R	probably damaging	Het
Pcdhga5	A	G	18: 37,695,948	D483G	possibly damaging	Het
Ralgapa1	C	T	12: 55,640,644	R2019Q	probably damaging	Het
Rbbp5	A	G	1: 132,484,758	T20A	probably benign	Het
Rere	T	C	4: 150,617,405	V1414A	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Ryr3	G	T	2: 112,910,407	N538K	probably damaging	Het
Serpina3j	C	A	12: 104,315,186	T206K	probably benign	Het
Skint11	C	A	4: 114,244,659	Q99K	probably benign	Het
Slc27a5	C	A	7: 12,988,443	C416F	probably benign	Het
Tas2r140	A	T	6: 133,054,952	V281D	probably damaging	Het
Tex30	A	T	1: 44,091,512	I32K	possibly damaging	Het
Trpc2	T	C	7: 102,088,135	I752T	possibly damaging	Het
Wnk2	A	G	13: 49,061,128	V1314A	probably benign	Het

Other mutations in Casp8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00684:Casp8	APN	1	58827314	critical splice donor site	probably null
IGL00825:Casp8	APN	1	58829006	missense	probably benign	0.02
IGL02025:Casp8	APN	1	58824147	missense	possibly damaging	0.81
IGL02549:Casp8	APN	1	58833766	missense	probably benign
amontillado	UTSW	1	58844770	missense	probably damaging	1.00
Porto	UTSW	1	58833698	missense	possibly damaging	0.89
IGL02991:Casp8	UTSW	1	58827279	missense	probably benign	0.00
R0609:Casp8	UTSW	1	58844792	missense	probably benign	0.00
R0960:Casp8	UTSW	1	58829013	critical splice donor site	probably null
R1433:Casp8	UTSW	1	58824124	missense	probably damaging	1.00
R1505:Casp8	UTSW	1	58828922	missense	probably damaging	0.99
R1506:Casp8	UTSW	1	58824196	missense	probably damaging	0.97
R1596:Casp8	UTSW	1	58831674	splice site	probably benign
R1674:Casp8	UTSW	1	58844416	missense	probably damaging	1.00
R1676:Casp8	UTSW	1	58844416	missense	probably damaging	1.00
R1981:Casp8	UTSW	1	58828962	synonymous	probably null
R3909:Casp8	UTSW	1	58844811	missense	probably damaging	1.00
R3911:Casp8	UTSW	1	58833705	missense	probably damaging	1.00
R4231:Casp8	UTSW	1	58844770	missense	probably damaging	1.00
R4233:Casp8	UTSW	1	58844770	missense	probably damaging	1.00
R4235:Casp8	UTSW	1	58833698	missense	possibly damaging	0.89
R4236:Casp8	UTSW	1	58844770	missense	probably damaging	1.00
R4917:Casp8	UTSW	1	58827218	missense	probably damaging	1.00
R4918:Casp8	UTSW	1	58827218	missense	probably damaging	1.00
R5063:Casp8	UTSW	1	58844374	missense	probably damaging	1.00
R5092:Casp8	UTSW	1	58844676	missense	possibly damaging	0.53
R5153:Casp8	UTSW	1	58844845	missense	probably benign	0.00
R5964:Casp8	UTSW	1	58833736	missense	possibly damaging	0.62
R5979:Casp8	UTSW	1	58828912	missense	probably benign
R7602:Casp8	UTSW	1	58833739	missense	probably benign	0.43
R7675:Casp8	UTSW	1	58823947

Predicted Primers

PCR Primer
(F):5'- TACTTCACTGGTTCAAAGTGCCC -3'
(R):5'- ACATGCCAATGGCTACTTCTCTG -3'

Sequencing Primer
(F):5'- TGTCTGGGAAACCCAAGATC -3'
(R):5'- TTATCTCGGCCATAAAGCAC -3'

Posted On

2015-06-12