Incidental Mutation 'R4234:Rufy4'
ID320992
Institutional Source Beutler Lab
Gene Symbol Rufy4
Ensembl Gene ENSMUSG00000061815
Gene NameRUN and FYVE domain containing 4
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R4234 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location74125541-74148223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74147663 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 537 (C537R)
Ref Sequence ENSEMBL: ENSMUSP00000115873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080167] [ENSMUST00000127134]
Predicted Effect probably damaging
Transcript: ENSMUST00000080167
AA Change: C453R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079062
Gene: ENSMUSG00000061815
AA Change: C453R

DomainStartEndE-ValueType
Pfam:RUN 2 81 1.5e-8 PFAM
coiled coil region 331 404 N/A INTRINSIC
Blast:FYVE 415 472 2e-6 BLAST
SCOP:d1vfya_ 428 473 4e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127134
AA Change: C537R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115873
Gene: ENSMUSG00000061815
AA Change: C537R

DomainStartEndE-ValueType
Pfam:RUN 41 165 6.2e-10 PFAM
coiled coil region 415 488 N/A INTRINSIC
Blast:FYVE 499 556 2e-6 BLAST
SCOP:d1vfya_ 512 557 3e-7 SMART
Meta Mutation Damage Score 0.8605 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Ap3s1 A T 18: 46,779,200 T96S probably benign Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Aspg T A 12: 112,123,316 Y429* probably null Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
BC034090 C T 1: 155,241,580 G264D probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cerk T C 15: 86,142,788 K174E probably benign Het
Col19a1 T C 1: 24,315,395 probably null Het
Cyp2c23 G T 19: 44,029,165 T8K unknown Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dok4 T C 8: 94,865,664 E232G probably damaging Het
Dpf1 T C 7: 29,315,632 S304P probably damaging Het
Dpyd T A 3: 119,431,584 I1002N probably damaging Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm1527 G A 3: 28,914,366 G189D probably damaging Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Lix1l T A 3: 96,623,657 probably null Het
Mdc1 T C 17: 35,848,824 C658R probably benign Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh15 G T 16: 49,163,042 V1507L probably benign Het
Nfe2l1 T C 11: 96,819,909 D210G probably damaging Het
Notch3 T A 17: 32,141,341 I1539F probably damaging Het
Pcdhac1 A C 18: 37,090,958 S275R probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rbbp5 A G 1: 132,484,758 T20A probably benign Het
Rere T C 4: 150,617,405 V1414A probably damaging Het
Ryr3 G T 2: 112,910,407 N538K probably damaging Het
Serpina3j C A 12: 104,315,186 T206K probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc27a5 C A 7: 12,988,443 C416F probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tex30 A T 1: 44,091,512 I32K possibly damaging Het
Trpc2 T C 7: 102,088,135 I752T possibly damaging Het
Wnk2 A G 13: 49,061,128 V1314A probably benign Het
Other mutations in Rufy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Rufy4 APN 1 74129354 missense probably damaging 1.00
IGL02075:Rufy4 APN 1 74129359 missense probably damaging 1.00
IGL02604:Rufy4 APN 1 74134189 missense probably damaging 1.00
IGL02606:Rufy4 APN 1 74133350 splice site probably benign
IGL02928:Rufy4 APN 1 74129082 unclassified probably benign
R0091:Rufy4 UTSW 1 74128936 unclassified probably benign
R0507:Rufy4 UTSW 1 74146716 missense probably benign 0.02
R0589:Rufy4 UTSW 1 74132883 missense probably damaging 1.00
R0595:Rufy4 UTSW 1 74140930 missense possibly damaging 0.94
R0742:Rufy4 UTSW 1 74146716 missense probably benign 0.02
R1533:Rufy4 UTSW 1 74129843 critical splice donor site probably null
R1666:Rufy4 UTSW 1 74147678 missense probably benign 0.06
R1668:Rufy4 UTSW 1 74147678 missense probably benign 0.06
R1827:Rufy4 UTSW 1 74134120 missense probably damaging 1.00
R2018:Rufy4 UTSW 1 74140947 missense possibly damaging 0.49
R2095:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2306:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2307:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2472:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2475:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3022:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3054:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3055:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3056:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3117:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3118:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3236:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3237:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3545:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3546:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3547:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3548:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3767:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3768:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3770:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3816:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3817:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3818:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3819:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3895:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4050:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4091:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4117:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4124:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4125:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4127:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4231:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4233:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4236:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4254:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4255:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4319:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4320:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4321:Rufy4 UTSW 1 74132784 missense possibly damaging 0.93
R4321:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4322:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4323:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4324:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4360:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4361:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4406:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4408:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4516:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4517:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4520:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4522:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4524:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4531:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4533:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4617:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4661:Rufy4 UTSW 1 74133107 missense probably damaging 0.99
R4778:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4779:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4840:Rufy4 UTSW 1 74129039 missense possibly damaging 0.82
R4897:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4898:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4899:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4915:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4917:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4918:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4997:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5092:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5097:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5189:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5191:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5195:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5196:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5197:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5226:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5227:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5228:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5230:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5372:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5373:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5374:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5375:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5376:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5377:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5378:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5699:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5748:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5750:Rufy4 UTSW 1 74132909 missense probably benign 0.01
R5767:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5865:Rufy4 UTSW 1 74146755 missense probably damaging 0.99
R6083:Rufy4 UTSW 1 74129397 missense probably damaging 0.99
R6149:Rufy4 UTSW 1 74147733 missense probably benign 0.15
R6279:Rufy4 UTSW 1 74133224 missense probably benign 0.00
R6300:Rufy4 UTSW 1 74133224 missense probably benign 0.00
R6629:Rufy4 UTSW 1 74132367 intron probably null
R6809:Rufy4 UTSW 1 74133047 missense probably benign 0.00
R7179:Rufy4 UTSW 1 74132876 missense probably benign 0.12
R7218:Rufy4 UTSW 1 74133015 missense probably damaging 0.99
R7453:Rufy4 UTSW 1 74129334 splice site probably null
X0023:Rufy4 UTSW 1 74141049 missense probably benign 0.04
X0025:Rufy4 UTSW 1 74133019 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAGCCATCAGGAGAAGCTG -3'
(R):5'- AGCTAGGCCTATCTGTGGACTG -3'

Sequencing Primer
(F):5'- GGAGAAGCTGCCACCTCAATTAG -3'
(R):5'- TGGACTGCCAGCTGTTCC -3'
Posted On2015-06-12