Incidental Mutation 'R4234:Rbbp5'
ID320993
Institutional Source Beutler Lab
Gene Symbol Rbbp5
Ensembl Gene ENSMUSG00000026439
Gene Nameretinoblastoma binding protein 5, histone lysine methyltransferase complex subunit
Synonyms4933411J24Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R4234 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location132477365-132505659 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132484758 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 20 (T20A)
Ref Sequence ENSEMBL: ENSMUSP00000141003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027700] [ENSMUST00000187505] [ENSMUST00000188575] [ENSMUST00000189786] [ENSMUST00000190825] [ENSMUST00000190997]
Predicted Effect probably benign
Transcript: ENSMUST00000027700
SMART Domains Protein: ENSMUSP00000027700
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187505
SMART Domains Protein: ENSMUSP00000141176
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
Blast:WD40 1 52 9e-13 BLAST
WD40 55 99 5.1e-3 SMART
WD40 114 153 7.9e-2 SMART
WD40 156 195 1.9e-2 SMART
low complexity region 217 231 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188575
AA Change: T20A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000140344
Gene: ENSMUSG00000026439
AA Change: T20A

DomainStartEndE-ValueType
Blast:WD40 14 55 9e-9 BLAST
SCOP:d1gxra_ 34 87 8e-8 SMART
Blast:WD40 58 107 8e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000189786
SMART Domains Protein: ENSMUSP00000140790
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 1 27 1.2e0 SMART
WD40 30 69 4.6e-9 SMART
Blast:WD40 72 149 2e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000190825
AA Change: T20A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000139519
Gene: ENSMUSG00000026439
AA Change: T20A

DomainStartEndE-ValueType
WD40 14 52 1.4e-3 SMART
WD40 55 94 4.6e-9 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 5.1e-3 SMART
WD40 241 280 7.9e-2 SMART
WD40 283 322 1.9e-2 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190997
AA Change: T20A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141003
Gene: ENSMUSG00000026439
AA Change: T20A

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed nuclear protein which belongs to a highly conserved subfamily of WD-repeat proteins. The encoded protein binds directly to retinoblastoma protein, which regulates cell proliferation. It interacts preferentially with the underphosphorylated retinoblastoma protein via the E1A-binding pocket B. Three alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Ap3s1 A T 18: 46,779,200 T96S probably benign Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Aspg T A 12: 112,123,316 Y429* probably null Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
BC034090 C T 1: 155,241,580 G264D probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cerk T C 15: 86,142,788 K174E probably benign Het
Col19a1 T C 1: 24,315,395 probably null Het
Cyp2c23 G T 19: 44,029,165 T8K unknown Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dok4 T C 8: 94,865,664 E232G probably damaging Het
Dpf1 T C 7: 29,315,632 S304P probably damaging Het
Dpyd T A 3: 119,431,584 I1002N probably damaging Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm1527 G A 3: 28,914,366 G189D probably damaging Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Lix1l T A 3: 96,623,657 probably null Het
Mdc1 T C 17: 35,848,824 C658R probably benign Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh15 G T 16: 49,163,042 V1507L probably benign Het
Nfe2l1 T C 11: 96,819,909 D210G probably damaging Het
Notch3 T A 17: 32,141,341 I1539F probably damaging Het
Pcdhac1 A C 18: 37,090,958 S275R probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rere T C 4: 150,617,405 V1414A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr3 G T 2: 112,910,407 N538K probably damaging Het
Serpina3j C A 12: 104,315,186 T206K probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc27a5 C A 7: 12,988,443 C416F probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tex30 A T 1: 44,091,512 I32K possibly damaging Het
Trpc2 T C 7: 102,088,135 I752T possibly damaging Het
Wnk2 A G 13: 49,061,128 V1314A probably benign Het
Other mutations in Rbbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Rbbp5 APN 1 132489706 missense probably damaging 1.00
IGL01373:Rbbp5 APN 1 132492601 missense probably benign 0.07
IGL01577:Rbbp5 APN 1 132492655 missense possibly damaging 0.68
IGL01728:Rbbp5 APN 1 132498080 missense probably benign
R0097:Rbbp5 UTSW 1 132490489 missense possibly damaging 0.81
R0420:Rbbp5 UTSW 1 132493844 missense possibly damaging 0.88
R1540:Rbbp5 UTSW 1 132494282 nonsense probably null
R1965:Rbbp5 UTSW 1 132494297 missense probably damaging 1.00
R2419:Rbbp5 UTSW 1 132493826 missense possibly damaging 0.95
R2924:Rbbp5 UTSW 1 132492663 critical splice donor site probably null
R3810:Rbbp5 UTSW 1 132492587 missense probably damaging 0.98
R3811:Rbbp5 UTSW 1 132492587 missense probably damaging 0.98
R5024:Rbbp5 UTSW 1 132490488 missense possibly damaging 0.65
R5166:Rbbp5 UTSW 1 132490565 missense possibly damaging 0.60
R5435:Rbbp5 UTSW 1 132494275 missense probably damaging 1.00
R6018:Rbbp5 UTSW 1 132494340 missense probably damaging 1.00
R6172:Rbbp5 UTSW 1 132496816 missense possibly damaging 0.89
R7500:Rbbp5 UTSW 1 132494141 missense probably benign 0.35
X0019:Rbbp5 UTSW 1 132489698 missense probably damaging 1.00
X0025:Rbbp5 UTSW 1 132489658 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTCCAAAGTACAGAGATCCATTATAC -3'
(R):5'- ACCTGCAATTAATACTGGGCC -3'

Sequencing Primer
(F):5'- CAGAGATCCATTATACCCATTTGAG -3'
(R):5'- CCCAGAATGTATATGATCCTGGGC -3'
Posted On2015-06-12