Incidental Mutation 'R4234:BC034090'
ID320994
Institutional Source Beutler Lab
Gene Symbol BC034090
Ensembl Gene ENSMUSG00000033722
Gene NamecDNA sequence BC034090
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4234 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location155212471-155244444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 155241580 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 264 (G264D)
Ref Sequence ENSEMBL: ENSMUSP00000139623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186156]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186082
Predicted Effect probably benign
Transcript: ENSMUST00000186156
AA Change: G264D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139623
Gene: ENSMUSG00000033722
AA Change: G264D

DomainStartEndE-ValueType
low complexity region 446 463 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 855 861 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
PDZ 1123 1198 2.2e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Ap3s1 A T 18: 46,779,200 T96S probably benign Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Aspg T A 12: 112,123,316 Y429* probably null Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cerk T C 15: 86,142,788 K174E probably benign Het
Col19a1 T C 1: 24,315,395 probably null Het
Cyp2c23 G T 19: 44,029,165 T8K unknown Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dok4 T C 8: 94,865,664 E232G probably damaging Het
Dpf1 T C 7: 29,315,632 S304P probably damaging Het
Dpyd T A 3: 119,431,584 I1002N probably damaging Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm1527 G A 3: 28,914,366 G189D probably damaging Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Lix1l T A 3: 96,623,657 probably null Het
Mdc1 T C 17: 35,848,824 C658R probably benign Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh15 G T 16: 49,163,042 V1507L probably benign Het
Nfe2l1 T C 11: 96,819,909 D210G probably damaging Het
Notch3 T A 17: 32,141,341 I1539F probably damaging Het
Pcdhac1 A C 18: 37,090,958 S275R probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rbbp5 A G 1: 132,484,758 T20A probably benign Het
Rere T C 4: 150,617,405 V1414A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr3 G T 2: 112,910,407 N538K probably damaging Het
Serpina3j C A 12: 104,315,186 T206K probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc27a5 C A 7: 12,988,443 C416F probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tex30 A T 1: 44,091,512 I32K possibly damaging Het
Trpc2 T C 7: 102,088,135 I752T possibly damaging Het
Wnk2 A G 13: 49,061,128 V1314A probably benign Het
Other mutations in BC034090
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:BC034090 APN 1 155225447 missense possibly damaging 0.95
IGL00159:BC034090 APN 1 155225451 nonsense probably null
IGL00481:BC034090 APN 1 155232521 missense probably benign 0.04
IGL01309:BC034090 APN 1 155226384 missense probably damaging 0.98
IGL01813:BC034090 APN 1 155226339 nonsense probably null
IGL01938:BC034090 APN 1 155232592 splice site probably null
IGL01982:BC034090 APN 1 155223332 missense probably damaging 1.00
IGL02115:BC034090 APN 1 155232651 intron probably benign
IGL02338:BC034090 APN 1 155217471 missense probably damaging 1.00
IGL02406:BC034090 APN 1 155225153 missense probably benign 0.00
IGL03243:BC034090 APN 1 155225655 missense possibly damaging 0.71
IGL03290:BC034090 APN 1 155226110 missense probably damaging 1.00
R0055:BC034090 UTSW 1 155241658 missense probably damaging 1.00
R1436:BC034090 UTSW 1 155225916 missense probably benign 0.04
R1649:BC034090 UTSW 1 155225573 missense possibly damaging 0.72
R1710:BC034090 UTSW 1 155225864 missense possibly damaging 0.82
R1819:BC034090 UTSW 1 155225829 missense possibly damaging 0.58
R1969:BC034090 UTSW 1 155225226 missense possibly damaging 0.90
R1996:BC034090 UTSW 1 155221594 unclassified probably benign
R2012:BC034090 UTSW 1 155221432 missense probably damaging 0.98
R2133:BC034090 UTSW 1 155225786 missense probably benign 0.27
R3426:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3427:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3428:BC034090 UTSW 1 155241498 missense probably benign 0.00
R3782:BC034090 UTSW 1 155226278 missense probably damaging 1.00
R3792:BC034090 UTSW 1 155241797 missense probably damaging 0.98
R4373:BC034090 UTSW 1 155226158 missense probably benign 0.22
R4377:BC034090 UTSW 1 155232450 missense probably benign 0.00
R4661:BC034090 UTSW 1 155232475 missense probably damaging 0.98
R4676:BC034090 UTSW 1 155226264 missense possibly damaging 0.60
R4729:BC034090 UTSW 1 155225090 missense probably damaging 1.00
R5170:BC034090 UTSW 1 155213650 missense probably damaging 1.00
R5340:BC034090 UTSW 1 155226414 missense possibly damaging 0.74
R5382:BC034090 UTSW 1 155225603 missense probably benign 0.09
R5384:BC034090 UTSW 1 155242027 missense possibly damaging 0.68
R5576:BC034090 UTSW 1 155241468 missense probably benign 0.01
R5891:BC034090 UTSW 1 155233047 unclassified probably benign
R6060:BC034090 UTSW 1 155241499 missense probably benign 0.00
R6092:BC034090 UTSW 1 155224913 missense probably damaging 0.99
R6662:BC034090 UTSW 1 155226339 missense possibly damaging 0.92
R6736:BC034090 UTSW 1 155241930 missense possibly damaging 0.92
R6903:BC034090 UTSW 1 155221385 missense probably benign 0.03
R6970:BC034090 UTSW 1 155241439 missense probably damaging 1.00
R7144:BC034090 UTSW 1 155242031 missense probably damaging 1.00
R7201:BC034090 UTSW 1 155241934 missense probably damaging 0.98
R7265:BC034090 UTSW 1 155225327 missense probably damaging 0.96
R7380:BC034090 UTSW 1 155232483 missense probably damaging 1.00
R7436:BC034090 UTSW 1 155226381 missense probably damaging 1.00
R7569:BC034090 UTSW 1 155217405 missense probably benign 0.00
R7587:BC034090 UTSW 1 155217486 missense probably damaging 1.00
R7664:BC034090 UTSW 1 155241631 missense probably damaging 1.00
R7737:BC034090 UTSW 1 155241673 missense possibly damaging 0.66
R7782:BC034090 UTSW 1 155232664 intron probably benign
X0002:BC034090 UTSW 1 155226279 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATTTGCTCCAACTCAGGCAG -3'
(R):5'- AGAAAGTCCCAACAATCGAGTTTC -3'

Sequencing Primer
(F):5'- TCAGGCAGTAAAATAAGGCTCAC -3'
(R):5'- ACAATCGAGTTTCTGCAGTCCAG -3'
Posted On2015-06-12