Incidental Mutation 'R4234:Rere'
ID 321007
Institutional Source Beutler Lab
Gene Symbol Rere
Ensembl Gene ENSMUSG00000039852
Gene Name arginine glutamic acid dipeptide (RE) repeats
Synonyms eye, eyes3, Atr2, atrophin-2, 1110033A15Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4234 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 150366103-150706423 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 150701862 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1414 (V1414A)
Ref Sequence ENSEMBL: ENSMUSP00000101307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105680] [ENSMUST00000105682] [ENSMUST00000136646]
AlphaFold Q80TZ9
Predicted Effect probably damaging
Transcript: ENSMUST00000105680
AA Change: V1146A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101305
Gene: ENSMUSG00000039852
AA Change: V1146A

DomainStartEndE-ValueType
ELM2 18 70 1.67e-13 SMART
SANT 124 173 1.8e-6 SMART
low complexity region 176 193 N/A INTRINSIC
ZnF_GATA 233 284 1.94e-15 SMART
Pfam:Atrophin-1 300 1290 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105682
AA Change: V1414A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101307
Gene: ENSMUSG00000039852
AA Change: V1414A

DomainStartEndE-ValueType
low complexity region 3 31 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
BAH 103 283 3.52e-13 SMART
ELM2 286 338 1.67e-13 SMART
SANT 392 441 1.8e-6 SMART
low complexity region 444 461 N/A INTRINSIC
ZnF_GATA 501 552 1.94e-15 SMART
Pfam:Atrophin-1 568 1557 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000136646
AA Change: V47A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121544
Gene: ENSMUSG00000039852
AA Change: V47A

DomainStartEndE-ValueType
Pfam:Atrophin-1 1 199 2.2e-122 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000219467
AA Change: V430A
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the atrophin family of arginine-glutamic acid (RE) dipeptide repeat-containing proteins. The encoded protein co-localizes with a transcription factor in the nucleus, and its overexpression triggers apoptosis. A similar protein in mouse associates with histone deacetylase and is thought to function as a transcriptional co-repressor during embryonic development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality with abnormalities in neural tube development, somite development, and in the embryonic heart. Mice homozygous for an ENU-induced allele exhibit narrow snouts, decreased body weight, renal agenesis and small eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 69,438,135 (GRCm39) A53T probably benign Het
Ahnak A T 19: 8,978,150 (GRCm39) K90* probably null Het
Ajuba T C 14: 54,806,983 (GRCm39) R490G probably damaging Het
Akap6 T A 12: 53,186,454 (GRCm39) N1289K probably damaging Het
Ankfy1 G A 11: 72,605,310 (GRCm39) probably null Het
Ap3s1 A T 18: 46,912,267 (GRCm39) T96S probably benign Het
Arhgap21 A G 2: 20,891,948 (GRCm39) V161A probably damaging Het
Arhgef18 T C 8: 3,500,317 (GRCm39) I541T possibly damaging Het
Aspg T A 12: 112,089,750 (GRCm39) Y429* probably null Het
Atg14 T C 14: 47,788,802 (GRCm39) K184E probably benign Het
BC034090 C T 1: 155,117,326 (GRCm39) G264D probably benign Het
Casp8 T C 1: 58,883,929 (GRCm39) V432A probably damaging Het
Cerk T C 15: 86,026,989 (GRCm39) K174E probably benign Het
Col19a1 T C 1: 24,354,476 (GRCm39) probably null Het
Cyp2c23 G T 19: 44,017,604 (GRCm39) T8K unknown Het
Ddx1 C T 12: 13,273,858 (GRCm39) V590I possibly damaging Het
Dok4 T C 8: 95,592,292 (GRCm39) E232G probably damaging Het
Dpf1 T C 7: 29,015,057 (GRCm39) S304P probably damaging Het
Dpyd T A 3: 119,225,233 (GRCm39) I1002N probably damaging Het
Fam107b T C 2: 3,771,777 (GRCm39) S3P possibly damaging Het
Gm1527 G A 3: 28,968,515 (GRCm39) G189D probably damaging Het
Hspa12b T C 2: 130,980,932 (GRCm39) V162A probably benign Het
Lix1l T A 3: 96,530,973 (GRCm39) probably null Het
Mdc1 T C 17: 36,159,716 (GRCm39) C658R probably benign Het
Mrps30 T C 13: 118,523,376 (GRCm39) D132G probably damaging Het
Myh15 G T 16: 48,983,405 (GRCm39) V1507L probably benign Het
Nfe2l1 T C 11: 96,710,735 (GRCm39) D210G probably damaging Het
Notch3 T A 17: 32,360,315 (GRCm39) I1539F probably damaging Het
Pcdhac1 A C 18: 37,224,011 (GRCm39) S275R probably damaging Het
Pcdhga5 A G 18: 37,829,001 (GRCm39) D483G possibly damaging Het
Ralgapa1 C T 12: 55,687,429 (GRCm39) R2019Q probably damaging Het
Rbbp5 A G 1: 132,412,496 (GRCm39) T20A probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Ryr3 G T 2: 112,740,752 (GRCm39) N538K probably damaging Het
Serpina3j C A 12: 104,281,445 (GRCm39) T206K probably benign Het
Skint11 C A 4: 114,101,856 (GRCm39) Q99K probably benign Het
Slc27a5 C A 7: 12,722,370 (GRCm39) C416F probably benign Het
Tas2r140 A T 6: 133,031,915 (GRCm39) V281D probably damaging Het
Tex30 A T 1: 44,130,672 (GRCm39) I32K possibly damaging Het
Trpc2 T C 7: 101,737,342 (GRCm39) I752T possibly damaging Het
Wnk2 A G 13: 49,214,604 (GRCm39) V1314A probably benign Het
Other mutations in Rere
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Rere APN 4 150,703,920 (GRCm39) missense probably damaging 1.00
IGL01465:Rere APN 4 150,594,451 (GRCm39) missense unknown
IGL01523:Rere APN 4 150,700,012 (GRCm39) missense possibly damaging 0.93
IGL01688:Rere APN 4 150,702,893 (GRCm39) missense probably damaging 1.00
IGL02057:Rere APN 4 150,699,289 (GRCm39) unclassified probably benign
IGL02621:Rere APN 4 150,698,269 (GRCm39) unclassified probably benign
IGL02672:Rere APN 4 150,594,483 (GRCm39) missense unknown
R0116:Rere UTSW 4 150,701,433 (GRCm39) missense probably benign 0.18
R0119:Rere UTSW 4 150,699,779 (GRCm39) unclassified probably benign
R0344:Rere UTSW 4 150,695,438 (GRCm39) unclassified probably benign
R0504:Rere UTSW 4 150,699,779 (GRCm39) unclassified probably benign
R0630:Rere UTSW 4 150,703,545 (GRCm39) missense probably damaging 1.00
R0961:Rere UTSW 4 150,699,829 (GRCm39) unclassified probably benign
R1164:Rere UTSW 4 150,619,341 (GRCm39) missense unknown
R1424:Rere UTSW 4 150,701,495 (GRCm39) missense probably damaging 1.00
R1542:Rere UTSW 4 150,700,399 (GRCm39) missense probably damaging 1.00
R1652:Rere UTSW 4 150,696,522 (GRCm39) unclassified probably benign
R1953:Rere UTSW 4 150,701,294 (GRCm39) missense probably damaging 1.00
R1959:Rere UTSW 4 150,553,247 (GRCm39) missense probably benign 0.23
R1966:Rere UTSW 4 150,701,330 (GRCm39) missense probably damaging 1.00
R1975:Rere UTSW 4 150,700,190 (GRCm39) missense probably damaging 0.99
R2070:Rere UTSW 4 150,699,047 (GRCm39) unclassified probably benign
R2115:Rere UTSW 4 150,697,018 (GRCm39) unclassified probably benign
R2144:Rere UTSW 4 150,701,388 (GRCm39) missense probably damaging 0.99
R2270:Rere UTSW 4 150,561,837 (GRCm39) missense unknown
R2969:Rere UTSW 4 150,654,673 (GRCm39) missense unknown
R3699:Rere UTSW 4 150,561,819 (GRCm39) critical splice acceptor site probably null
R3723:Rere UTSW 4 150,553,252 (GRCm39) missense probably damaging 1.00
R3826:Rere UTSW 4 150,554,785 (GRCm39) missense probably benign 0.42
R4512:Rere UTSW 4 150,561,909 (GRCm39) missense unknown
R4798:Rere UTSW 4 150,699,624 (GRCm39) unclassified probably benign
R4883:Rere UTSW 4 150,700,510 (GRCm39) missense probably damaging 0.98
R4914:Rere UTSW 4 150,703,601 (GRCm39) missense probably damaging 1.00
R4916:Rere UTSW 4 150,703,601 (GRCm39) missense probably damaging 1.00
R4917:Rere UTSW 4 150,703,601 (GRCm39) missense probably damaging 1.00
R4918:Rere UTSW 4 150,703,601 (GRCm39) missense probably damaging 1.00
R4966:Rere UTSW 4 150,698,273 (GRCm39) unclassified probably benign
R5172:Rere UTSW 4 150,654,726 (GRCm39) missense unknown
R5643:Rere UTSW 4 150,701,700 (GRCm39) missense probably damaging 1.00
R6058:Rere UTSW 4 150,553,255 (GRCm39) missense probably damaging 1.00
R7112:Rere UTSW 4 150,491,061 (GRCm39) missense probably benign
R7173:Rere UTSW 4 150,553,195 (GRCm39) missense probably damaging 1.00
R7190:Rere UTSW 4 150,695,410 (GRCm39) missense unknown
R7699:Rere UTSW 4 150,701,555 (GRCm39) missense
R7990:Rere UTSW 4 150,699,327 (GRCm39) missense unknown
R8070:Rere UTSW 4 150,701,832 (GRCm39) missense probably damaging 1.00
R8101:Rere UTSW 4 150,701,796 (GRCm39) missense probably damaging 1.00
R8103:Rere UTSW 4 150,701,796 (GRCm39) missense probably damaging 1.00
R8215:Rere UTSW 4 150,701,424 (GRCm39) missense possibly damaging 0.95
R8254:Rere UTSW 4 150,697,129 (GRCm39) missense unknown
R8348:Rere UTSW 4 150,703,653 (GRCm39) missense probably damaging 1.00
R8448:Rere UTSW 4 150,703,653 (GRCm39) missense probably damaging 1.00
R8725:Rere UTSW 4 150,701,792 (GRCm39) nonsense probably null
R8790:Rere UTSW 4 150,593,332 (GRCm39) missense unknown
R8921:Rere UTSW 4 150,696,471 (GRCm39) missense unknown
R8937:Rere UTSW 4 150,699,331 (GRCm39) unclassified probably benign
R9345:Rere UTSW 4 150,554,770 (GRCm39) missense probably damaging 0.99
R9377:Rere UTSW 4 150,593,342 (GRCm39) missense unknown
R9490:Rere UTSW 4 150,516,040 (GRCm39) missense probably benign 0.16
R9523:Rere UTSW 4 150,703,636 (GRCm39) missense probably damaging 0.98
R9653:Rere UTSW 4 150,516,010 (GRCm39) missense probably benign 0.28
R9657:Rere UTSW 4 150,699,390 (GRCm39) missense unknown
Z1176:Rere UTSW 4 150,553,240 (GRCm39) missense probably damaging 1.00
Z1177:Rere UTSW 4 150,700,268 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- ACCCCATGGAGCATTTTGC -3'
(R):5'- CAGGACTAGGCTTCTCTAGAGG -3'

Sequencing Primer
(F):5'- ATGGAGCATTTTGCCCGGC -3'
(R):5'- GCCTTGCTTCTGAATTGG -3'
Posted On 2015-06-12