Incidental Mutation 'R4234:Slc27a5'
ID321010
Institutional Source Beutler Lab
Gene Symbol Slc27a5
Ensembl Gene ENSMUSG00000030382
Gene Namesolute carrier family 27 (fatty acid transporter), member 5
SynonymsVLCSH2, FATP5, FACVL3, VLCS-H2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R4234 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12988346-12998192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 12988443 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 416 (C416F)
Ref Sequence ENSEMBL: ENSMUSP00000112495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032539] [ENSMUST00000045810] [ENSMUST00000108536] [ENSMUST00000120903]
Predicted Effect probably benign
Transcript: ENSMUST00000032539
SMART Domains Protein: ENSMUSP00000032539
Gene: ENSMUSG00000030382

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 58 77 N/A INTRINSIC
Pfam:AMP-binding 119 557 1.3e-64 PFAM
Pfam:AMP-binding_C 565 641 1.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045810
SMART Domains Protein: ENSMUSP00000039073
Gene: ENSMUSG00000033961

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
SCAN 122 234 1.29e-53 SMART
KRAB 299 360 3.96e-2 SMART
ZnF_C2H2 419 441 2.95e-3 SMART
ZnF_C2H2 468 490 8.47e-4 SMART
ZnF_C2H2 496 518 5.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108536
SMART Domains Protein: ENSMUSP00000104176
Gene: ENSMUSG00000033961

DomainStartEndE-ValueType
SCAN 22 134 1.29e-53 SMART
KRAB 199 260 3.96e-2 SMART
ZnF_C2H2 319 341 2.95e-3 SMART
ZnF_C2H2 368 390 8.47e-4 SMART
ZnF_C2H2 396 418 5.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120903
AA Change: C416F

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000112495
Gene: ENSMUSG00000030382
AA Change: C416F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 58 77 N/A INTRINSIC
Pfam:AMP-binding 119 414 2e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129268
AA Change: C149F
Predicted Effect probably benign
Transcript: ENSMUST00000133977
SMART Domains Protein: ENSMUSP00000117208
Gene: ENSMUSG00000030382

DomainStartEndE-ValueType
Pfam:AMP-binding 1 102 3.3e-8 PFAM
Pfam:AMP-binding 100 195 1.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155192
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of very long-chain acyl-CoA synthetase (VLCS). It is capable of activating very long-chain fatty-acids containing 24- and 26-carbons. It is expressed in liver and associated with endoplasmic reticulum but not with peroxisomes. Its primary role is in fatty acid elongation or complex lipid synthesis rather than in degradation. This gene has a mouse ortholog. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit altered lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Ap3s1 A T 18: 46,779,200 T96S probably benign Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Aspg T A 12: 112,123,316 Y429* probably null Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
BC034090 C T 1: 155,241,580 G264D probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cerk T C 15: 86,142,788 K174E probably benign Het
Col19a1 T C 1: 24,315,395 probably null Het
Cyp2c23 G T 19: 44,029,165 T8K unknown Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dok4 T C 8: 94,865,664 E232G probably damaging Het
Dpf1 T C 7: 29,315,632 S304P probably damaging Het
Dpyd T A 3: 119,431,584 I1002N probably damaging Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm1527 G A 3: 28,914,366 G189D probably damaging Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Lix1l T A 3: 96,623,657 probably null Het
Mdc1 T C 17: 35,848,824 C658R probably benign Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh15 G T 16: 49,163,042 V1507L probably benign Het
Nfe2l1 T C 11: 96,819,909 D210G probably damaging Het
Notch3 T A 17: 32,141,341 I1539F probably damaging Het
Pcdhac1 A C 18: 37,090,958 S275R probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rbbp5 A G 1: 132,484,758 T20A probably benign Het
Rere T C 4: 150,617,405 V1414A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr3 G T 2: 112,910,407 N538K probably damaging Het
Serpina3j C A 12: 104,315,186 T206K probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tex30 A T 1: 44,091,512 I32K possibly damaging Het
Trpc2 T C 7: 102,088,135 I752T possibly damaging Het
Wnk2 A G 13: 49,061,128 V1314A probably benign Het
Other mutations in Slc27a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Slc27a5 APN 7 12988639 missense probably benign 0.08
IGL00906:Slc27a5 APN 7 12991057 missense probably benign 0.00
IGL01067:Slc27a5 APN 7 12989072 missense probably damaging 1.00
IGL02101:Slc27a5 APN 7 12993343 missense possibly damaging 0.95
IGL02148:Slc27a5 APN 7 12994951 missense probably damaging 0.97
IGL02165:Slc27a5 APN 7 12994948 missense probably damaging 0.99
IGL02324:Slc27a5 APN 7 12997560 missense probably benign 0.00
IGL02879:Slc27a5 APN 7 12995044 splice site probably benign
R1519:Slc27a5 UTSW 7 12988459 splice site probably null
R1662:Slc27a5 UTSW 7 12991246 missense probably damaging 1.00
R1774:Slc27a5 UTSW 7 12997607 nonsense probably null
R2012:Slc27a5 UTSW 7 12997707 missense probably damaging 0.98
R2020:Slc27a5 UTSW 7 12993412 missense probably damaging 1.00
R2886:Slc27a5 UTSW 7 12989560 unclassified probably benign
R4855:Slc27a5 UTSW 7 12988633 missense probably benign 0.00
R5126:Slc27a5 UTSW 7 12991320 missense probably damaging 1.00
R5450:Slc27a5 UTSW 7 12994942 missense probably benign 0.04
R5712:Slc27a5 UTSW 7 12998083 unclassified probably benign
R6302:Slc27a5 UTSW 7 12988552 missense probably damaging 1.00
R6346:Slc27a5 UTSW 7 12990972 missense possibly damaging 0.75
R6866:Slc27a5 UTSW 7 12997516 missense probably benign 0.00
R6921:Slc27a5 UTSW 7 12991208 missense probably damaging 1.00
R7329:Slc27a5 UTSW 7 12991162 missense possibly damaging 0.75
R8017:Slc27a5 UTSW 7 12989402 missense probably damaging 1.00
R8019:Slc27a5 UTSW 7 12989402 missense probably damaging 1.00
R8312:Slc27a5 UTSW 7 12991287 missense probably damaging 1.00
Z1177:Slc27a5 UTSW 7 12988855 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGTCCTTGGCAGAGAACTC -3'
(R):5'- TACCGCTTTGCAGGATTCC -3'

Sequencing Primer
(F):5'- CTCTGTAGCAGGGTGGGGTAG -3'
(R):5'- CCTACAAGCTGGTAAAGTCACGG -3'
Posted On2015-06-12