Incidental Mutation 'R4234:Dpf1'
ID321011
Institutional Source Beutler Lab
Gene Symbol Dpf1
Ensembl Gene ENSMUSG00000030584
Gene NameD4, zinc and double PHD fingers family 1
Synonymsneuro-d4, Neud4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4234 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location29303951-29318243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29315632 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 304 (S304P)
Ref Sequence ENSEMBL: ENSMUSP00000103866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049977] [ENSMUST00000065181] [ENSMUST00000085809] [ENSMUST00000108230] [ENSMUST00000108231] [ENSMUST00000183096]
Predicted Effect probably damaging
Transcript: ENSMUST00000049977
AA Change: S304P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054385
Gene: ENSMUSG00000030584
AA Change: S304P

DomainStartEndE-ValueType
Pfam:Requiem_N 12 85 1.6e-39 PFAM
ZnF_C2H2 196 219 2.4e-3 SMART
PHD 274 327 8.98e-7 SMART
RING 275 326 1.06e1 SMART
PHD 328 374 2.6e-12 SMART
RING 329 373 8.53e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065181
AA Change: S303P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070539
Gene: ENSMUSG00000030584
AA Change: S303P

DomainStartEndE-ValueType
Pfam:Requiem_N 11 84 2e-39 PFAM
ZnF_C2H2 195 218 2.4e-3 SMART
PHD 273 326 8.98e-7 SMART
RING 274 325 1.06e1 SMART
PHD 327 373 2.6e-12 SMART
RING 328 372 8.53e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085809
SMART Domains Protein: ENSMUSP00000082965
Gene: ENSMUSG00000030583

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 361 380 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
Pfam:Rap_GAP 634 816 1.7e-68 PFAM
PDZ 969 1035 1.39e-8 SMART
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1260 1277 N/A INTRINSIC
low complexity region 1283 1294 N/A INTRINSIC
Pfam:SPAR_C 1471 1721 1.6e-96 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108230
AA Change: S259P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103865
Gene: ENSMUSG00000030584
AA Change: S259P

DomainStartEndE-ValueType
Pfam:Requiem_N 11 84 9.7e-40 PFAM
PHD 229 282 8.98e-7 SMART
RING 230 281 1.06e1 SMART
PHD 283 339 6.85e-12 SMART
RING 284 338 9.5e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108231
AA Change: S304P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103866
Gene: ENSMUSG00000030584
AA Change: S304P

DomainStartEndE-ValueType
Pfam:Requiem_N 13 84 1.2e-39 PFAM
ZnF_C2H2 196 219 2.4e-3 SMART
PHD 274 327 8.98e-7 SMART
RING 275 326 1.06e1 SMART
PHD 328 384 6.85e-12 SMART
RING 329 383 9.5e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128145
Predicted Effect probably benign
Transcript: ENSMUST00000137848
SMART Domains Protein: ENSMUSP00000120956
Gene: ENSMUSG00000030584

DomainStartEndE-ValueType
Pfam:Requiem_N 1 40 8.9e-20 PFAM
ZnF_C2H2 122 143 5.34e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138993
Predicted Effect probably damaging
Transcript: ENSMUST00000142958
AA Change: S111P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117186
Gene: ENSMUSG00000030584
AA Change: S111P

DomainStartEndE-ValueType
ZnF_C2H2 21 44 2.4e-3 SMART
PHD 82 135 8.98e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182223
Predicted Effect probably benign
Transcript: ENSMUST00000183096
SMART Domains Protein: ENSMUSP00000138171
Gene: ENSMUSG00000030583

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 361 380 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
Pfam:Rap_GAP 634 822 6.7e-64 PFAM
PDZ 969 1035 1.39e-8 SMART
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1260 1277 N/A INTRINSIC
low complexity region 1283 1294 N/A INTRINSIC
Pfam:DUF3401 1471 1721 7.2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207677
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Ap3s1 A T 18: 46,779,200 T96S probably benign Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Aspg T A 12: 112,123,316 Y429* probably null Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
BC034090 C T 1: 155,241,580 G264D probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cerk T C 15: 86,142,788 K174E probably benign Het
Col19a1 T C 1: 24,315,395 probably null Het
Cyp2c23 G T 19: 44,029,165 T8K unknown Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dok4 T C 8: 94,865,664 E232G probably damaging Het
Dpyd T A 3: 119,431,584 I1002N probably damaging Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm1527 G A 3: 28,914,366 G189D probably damaging Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Lix1l T A 3: 96,623,657 probably null Het
Mdc1 T C 17: 35,848,824 C658R probably benign Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh15 G T 16: 49,163,042 V1507L probably benign Het
Nfe2l1 T C 11: 96,819,909 D210G probably damaging Het
Notch3 T A 17: 32,141,341 I1539F probably damaging Het
Pcdhac1 A C 18: 37,090,958 S275R probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rbbp5 A G 1: 132,484,758 T20A probably benign Het
Rere T C 4: 150,617,405 V1414A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr3 G T 2: 112,910,407 N538K probably damaging Het
Serpina3j C A 12: 104,315,186 T206K probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc27a5 C A 7: 12,988,443 C416F probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tex30 A T 1: 44,091,512 I32K possibly damaging Het
Trpc2 T C 7: 102,088,135 I752T possibly damaging Het
Wnk2 A G 13: 49,061,128 V1314A probably benign Het
Other mutations in Dpf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Dpf1 APN 7 29316556 unclassified probably benign
IGL00736:Dpf1 APN 7 29312908 nonsense probably null
IGL01804:Dpf1 APN 7 29316501 missense probably damaging 1.00
IGL01942:Dpf1 APN 7 29316502 missense probably damaging 1.00
IGL01953:Dpf1 APN 7 29314307 missense probably damaging 1.00
IGL03191:Dpf1 APN 7 29316561 unclassified probably benign
R3622:Dpf1 UTSW 7 29316206 unclassified probably null
R3924:Dpf1 UTSW 7 29311673 missense possibly damaging 0.76
R4606:Dpf1 UTSW 7 29316590 unclassified probably benign
R5379:Dpf1 UTSW 7 29304108 missense probably benign 0.02
R5434:Dpf1 UTSW 7 29311331 missense possibly damaging 0.92
R6185:Dpf1 UTSW 7 29311271 missense possibly damaging 0.92
R6672:Dpf1 UTSW 7 29316268 missense probably damaging 1.00
R6816:Dpf1 UTSW 7 29311662 missense possibly damaging 0.61
R7240:Dpf1 UTSW 7 29311627 missense probably benign 0.01
R7796:Dpf1 UTSW 7 29311681 missense possibly damaging 0.69
R8071:Dpf1 UTSW 7 29314141 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCATGGTGGCTGAGTAGGAGAC -3'
(R):5'- CACGCTAATGCTGGTCACTG -3'

Sequencing Primer
(F):5'- GAGACTGTGGTGGCCAAC -3'
(R):5'- CAAGGAAGACTTTTAGGCCTCATG -3'
Posted On2015-06-12