Incidental Mutation 'R4234:Trpc2'
ID321013
Institutional Source Beutler Lab
Gene Symbol Trpc2
Ensembl Gene ENSMUSG00000100254
Gene Nametransient receptor potential cation channel, subfamily C, member 2
Synonymstrp2, mTrp2, TRPC2a, TRPC2b, 3010009O07Rik, Trrp2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4234 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102083116-102096396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102088135 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 752 (I752T)
Ref Sequence ENSEMBL: ENSMUSP00000081903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084843] [ENSMUST00000094129] [ENSMUST00000106950] [ENSMUST00000123372] [ENSMUST00000124189] [ENSMUST00000139104] [ENSMUST00000142629]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084843
AA Change: I752T

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081903
Gene: ENSMUSG00000070425
AA Change: I752T

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 150 1.4e-54 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
low complexity region 403 415 N/A INTRINSIC
low complexity region 416 428 N/A INTRINSIC
ANK 439 469 1.58e3 SMART
low complexity region 484 496 N/A INTRINSIC
ANK 522 551 1.74e0 SMART
Pfam:TRP_2 557 619 1e-24 PFAM
Pfam:Ion_trans 716 1024 1.7e-24 PFAM
Pfam:PKD_channel 774 1019 2.4e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1122 1162 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000094129
AA Change: I752T

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091679
Gene: ENSMUSG00000070425
AA Change: I752T

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 152 1.2e-27 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
low complexity region 403 415 N/A INTRINSIC
low complexity region 416 428 N/A INTRINSIC
ANK 439 469 1.58e3 SMART
low complexity region 484 496 N/A INTRINSIC
ANK 522 551 1.74e0 SMART
Pfam:TRP_2 557 619 2.8e-28 PFAM
transmembrane domain 719 741 N/A INTRINSIC
Pfam:PKD_channel 772 1019 3.8e-12 PFAM
Pfam:Ion_trans 796 1012 3.9e-31 PFAM
low complexity region 1070 1081 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1122 1162 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106950
SMART Domains Protein: ENSMUSP00000102563
Gene: ENSMUSG00000099481

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 152 5.2e-29 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
internal_repeat_1 324 345 2.69e-6 PROSPERO
low complexity region 346 379 N/A INTRINSIC
internal_repeat_1 380 401 2.69e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000123372
SMART Domains Protein: ENSMUSP00000121068
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 152 5.2e-29 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
internal_repeat_1 324 345 2.69e-6 PROSPERO
low complexity region 346 379 N/A INTRINSIC
internal_repeat_1 380 401 2.69e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000124189
AA Change: I378T

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116934
Gene: ENSMUSG00000100254
AA Change: I378T

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
low complexity region 42 54 N/A INTRINSIC
ANK 65 95 1.58e3 SMART
low complexity region 110 122 N/A INTRINSIC
ANK 148 177 1.74e0 SMART
Pfam:TRP_2 183 245 9.1e-29 PFAM
transmembrane domain 345 367 N/A INTRINSIC
Pfam:PKD_channel 398 645 1.4e-12 PFAM
Pfam:Ion_trans 422 638 1e-31 PFAM
low complexity region 696 707 N/A INTRINSIC
low complexity region 719 730 N/A INTRINSIC
coiled coil region 748 788 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139104
SMART Domains Protein: ENSMUSP00000122430
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 62 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142629
Predicted Effect probably benign
Transcript: ENSMUST00000155078
SMART Domains Protein: ENSMUSP00000123466
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 62 4.4e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit altered sexual and social behavior, including intermale mounting and a lack of aggressive behavior in the presence of invading males. Homozygotes for another allele show increased triglyceride levels in both males and femalesand increased cholesterol in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Ap3s1 A T 18: 46,779,200 T96S probably benign Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Aspg T A 12: 112,123,316 Y429* probably null Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
BC034090 C T 1: 155,241,580 G264D probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cerk T C 15: 86,142,788 K174E probably benign Het
Col19a1 T C 1: 24,315,395 probably null Het
Cyp2c23 G T 19: 44,029,165 T8K unknown Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dok4 T C 8: 94,865,664 E232G probably damaging Het
Dpf1 T C 7: 29,315,632 S304P probably damaging Het
Dpyd T A 3: 119,431,584 I1002N probably damaging Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm1527 G A 3: 28,914,366 G189D probably damaging Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Lix1l T A 3: 96,623,657 probably null Het
Mdc1 T C 17: 35,848,824 C658R probably benign Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh15 G T 16: 49,163,042 V1507L probably benign Het
Nfe2l1 T C 11: 96,819,909 D210G probably damaging Het
Notch3 T A 17: 32,141,341 I1539F probably damaging Het
Pcdhac1 A C 18: 37,090,958 S275R probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rbbp5 A G 1: 132,484,758 T20A probably benign Het
Rere T C 4: 150,617,405 V1414A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr3 G T 2: 112,910,407 N538K probably damaging Het
Serpina3j C A 12: 104,315,186 T206K probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc27a5 C A 7: 12,988,443 C416F probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tex30 A T 1: 44,091,512 I32K possibly damaging Het
Wnk2 A G 13: 49,061,128 V1314A probably benign Het
Other mutations in Trpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0443:Trpc2 UTSW 7 102093520 splice site probably benign
R0601:Trpc2 UTSW 7 102084365 missense possibly damaging 0.53
R1303:Trpc2 UTSW 7 102088161 missense probably damaging 1.00
R1493:Trpc2 UTSW 7 102090576 missense probably damaging 0.97
R1579:Trpc2 UTSW 7 102084240 missense probably damaging 0.99
R1829:Trpc2 UTSW 7 102084119 missense probably damaging 1.00
R2010:Trpc2 UTSW 7 102094573 missense probably benign
R3103:Trpc2 UTSW 7 102095234 missense possibly damaging 0.74
R3738:Trpc2 UTSW 7 102084504 missense probably damaging 1.00
R3739:Trpc2 UTSW 7 102084504 missense probably damaging 1.00
R3938:Trpc2 UTSW 7 102093574 missense probably damaging 1.00
R3945:Trpc2 UTSW 7 102088279 missense possibly damaging 0.52
R3951:Trpc2 UTSW 7 102093574 missense probably damaging 1.00
R3970:Trpc2 UTSW 7 102084324 missense probably damaging 1.00
R4035:Trpc2 UTSW 7 102084504 missense probably damaging 1.00
R4329:Trpc2 UTSW 7 102087520 missense probably damaging 1.00
R4531:Trpc2 UTSW 7 102095998 missense probably damaging 1.00
R4857:Trpc2 UTSW 7 102083969 missense probably benign 0.18
R5058:Trpc2 UTSW 7 102089109 missense probably damaging 1.00
R5093:Trpc2 UTSW 7 102095183 missense probably benign
R5485:Trpc2 UTSW 7 102095213 frame shift probably null
R5486:Trpc2 UTSW 7 102095213 frame shift probably null
R5487:Trpc2 UTSW 7 102095213 frame shift probably null
R5782:Trpc2 UTSW 7 102083979 missense possibly damaging 0.85
R6379:Trpc2 UTSW 7 102096091 nonsense probably null
R6572:Trpc2 UTSW 7 102090006 missense probably damaging 1.00
R6674:Trpc2 UTSW 7 102096057 missense probably benign 0.36
R7513:Trpc2 UTSW 7 102090068 missense probably damaging 0.99
RF020:Trpc2 UTSW 7 102096226 missense unknown
Z1176:Trpc2 UTSW 7 102095297 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCATGGTTATAAAGGAGAGATCAG -3'
(R):5'- GCTAGCCACAAGTAAAGGGC -3'

Sequencing Primer
(F):5'- ATAGAGGGCCTCATGCATACTC -3'
(R):5'- GTAAAGGGCTCTCTCATACACACCTG -3'
Posted On2015-06-12