Incidental Mutation 'R4234:Dok4'
ID321015
Institutional Source Beutler Lab
Gene Symbol Dok4
Ensembl Gene ENSMUSG00000040631
Gene Namedocking protein 4
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.423) question?
Stock #R4234 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location94863828-94876330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94865664 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 232 (E232G)
Ref Sequence ENSEMBL: ENSMUSP00000148355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046461] [ENSMUST00000109521] [ENSMUST00000211892] [ENSMUST00000211939] [ENSMUST00000212810]
Predicted Effect probably damaging
Transcript: ENSMUST00000046461
AA Change: E232G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043554
Gene: ENSMUSG00000040631
AA Change: E232G

DomainStartEndE-ValueType
PH 8 114 5.09e-6 SMART
PTBI 130 232 2.82e-57 SMART
IRS 135 232 5.51e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109521
SMART Domains Protein: ENSMUSP00000105147
Gene: ENSMUSG00000031783

DomainStartEndE-ValueType
RPOLD 18 262 6.79e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211892
Predicted Effect probably benign
Transcript: ENSMUST00000211939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212120
Predicted Effect probably benign
Transcript: ENSMUST00000212124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212744
Predicted Effect probably damaging
Transcript: ENSMUST00000212810
AA Change: E232G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000212848
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Ap3s1 A T 18: 46,779,200 T96S probably benign Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Aspg T A 12: 112,123,316 Y429* probably null Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
BC034090 C T 1: 155,241,580 G264D probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cerk T C 15: 86,142,788 K174E probably benign Het
Col19a1 T C 1: 24,315,395 probably null Het
Cyp2c23 G T 19: 44,029,165 T8K unknown Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dpf1 T C 7: 29,315,632 S304P probably damaging Het
Dpyd T A 3: 119,431,584 I1002N probably damaging Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm1527 G A 3: 28,914,366 G189D probably damaging Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Lix1l T A 3: 96,623,657 probably null Het
Mdc1 T C 17: 35,848,824 C658R probably benign Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh15 G T 16: 49,163,042 V1507L probably benign Het
Nfe2l1 T C 11: 96,819,909 D210G probably damaging Het
Notch3 T A 17: 32,141,341 I1539F probably damaging Het
Pcdhac1 A C 18: 37,090,958 S275R probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rbbp5 A G 1: 132,484,758 T20A probably benign Het
Rere T C 4: 150,617,405 V1414A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr3 G T 2: 112,910,407 N538K probably damaging Het
Serpina3j C A 12: 104,315,186 T206K probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc27a5 C A 7: 12,988,443 C416F probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tex30 A T 1: 44,091,512 I32K possibly damaging Het
Trpc2 T C 7: 102,088,135 I752T possibly damaging Het
Wnk2 A G 13: 49,061,128 V1314A probably benign Het
Other mutations in Dok4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Dok4 APN 8 94866802 missense probably benign 0.13
IGL02955:Dok4 APN 8 94865628 missense probably damaging 1.00
R0133:Dok4 UTSW 8 94865363 missense probably benign 0.05
R0492:Dok4 UTSW 8 94865136 missense probably benign 0.00
R0538:Dok4 UTSW 8 94865238 missense probably damaging 1.00
R0689:Dok4 UTSW 8 94870919 missense probably benign 0.17
R2261:Dok4 UTSW 8 94866512 missense probably damaging 0.96
R2262:Dok4 UTSW 8 94866512 missense probably damaging 0.96
R2263:Dok4 UTSW 8 94866512 missense probably damaging 0.96
R4771:Dok4 UTSW 8 94865167 unclassified probably null
R7497:Dok4 UTSW 8 94867425 missense possibly damaging 0.86
R7674:Dok4 UTSW 8 94866562 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCATCTGTGAGTTCTGGG -3'
(R):5'- GGCATTTAGAACTTGCATGCG -3'

Sequencing Primer
(F):5'- CCATCTGTGAGTTCTGGGGACAC -3'
(R):5'- CGCTCATGCTCGCACAC -3'
Posted On2015-06-12