Incidental Mutation 'R4234:Aspg'
ID321023
Institutional Source Beutler Lab
Gene Symbol Aspg
Ensembl Gene ENSMUSG00000037686
Gene Nameasparaginase
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R4234 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location112106679-112127559 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 112123316 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 429 (Y429*)
Ref Sequence ENSEMBL: ENSMUSP00000078369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079400] [ENSMUST00000223184]
Predicted Effect probably null
Transcript: ENSMUST00000079400
AA Change: Y429*
SMART Domains Protein: ENSMUSP00000078369
Gene: ENSMUSG00000037686
AA Change: Y429*

DomainStartEndE-ValueType
Asparaginase 10 348 2.67e-111 SMART
ANK 396 426 4.05e2 SMART
ANK 430 459 4.46e-7 SMART
ANK 463 494 1.1e2 SMART
ANK 530 559 4.73e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222645
Predicted Effect probably benign
Transcript: ENSMUST00000222970
Predicted Effect probably benign
Transcript: ENSMUST00000223184
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Ap3s1 A T 18: 46,779,200 T96S probably benign Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
BC034090 C T 1: 155,241,580 G264D probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cerk T C 15: 86,142,788 K174E probably benign Het
Col19a1 T C 1: 24,315,395 probably null Het
Cyp2c23 G T 19: 44,029,165 T8K unknown Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dok4 T C 8: 94,865,664 E232G probably damaging Het
Dpf1 T C 7: 29,315,632 S304P probably damaging Het
Dpyd T A 3: 119,431,584 I1002N probably damaging Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm1527 G A 3: 28,914,366 G189D probably damaging Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Lix1l T A 3: 96,623,657 probably null Het
Mdc1 T C 17: 35,848,824 C658R probably benign Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh15 G T 16: 49,163,042 V1507L probably benign Het
Nfe2l1 T C 11: 96,819,909 D210G probably damaging Het
Notch3 T A 17: 32,141,341 I1539F probably damaging Het
Pcdhac1 A C 18: 37,090,958 S275R probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rbbp5 A G 1: 132,484,758 T20A probably benign Het
Rere T C 4: 150,617,405 V1414A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr3 G T 2: 112,910,407 N538K probably damaging Het
Serpina3j C A 12: 104,315,186 T206K probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc27a5 C A 7: 12,988,443 C416F probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tex30 A T 1: 44,091,512 I32K possibly damaging Het
Trpc2 T C 7: 102,088,135 I752T possibly damaging Het
Wnk2 A G 13: 49,061,128 V1314A probably benign Het
Other mutations in Aspg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Aspg APN 12 112122953 missense probably benign
IGL02199:Aspg APN 12 112120992 missense probably benign 0.39
R0704:Aspg UTSW 12 112114472 missense probably damaging 1.00
R0730:Aspg UTSW 12 112112259 nonsense probably null
R1196:Aspg UTSW 12 112116524 missense possibly damaging 0.94
R1270:Aspg UTSW 12 112116447 missense probably damaging 1.00
R1466:Aspg UTSW 12 112121852 missense probably benign 0.20
R1466:Aspg UTSW 12 112121852 missense probably benign 0.20
R1592:Aspg UTSW 12 112119972 missense probably benign 0.17
R1826:Aspg UTSW 12 112123418 missense probably damaging 0.99
R1859:Aspg UTSW 12 112121172 missense possibly damaging 0.86
R2124:Aspg UTSW 12 112121174 missense probably benign 0.15
R2154:Aspg UTSW 12 112120974 missense probably benign 0.01
R2190:Aspg UTSW 12 112124888 missense probably damaging 0.96
R2221:Aspg UTSW 12 112114434 missense probably damaging 1.00
R2223:Aspg UTSW 12 112114434 missense probably damaging 1.00
R3907:Aspg UTSW 12 112112259 nonsense probably null
R4258:Aspg UTSW 12 112121253 missense probably benign 0.00
R4270:Aspg UTSW 12 112121195 missense probably damaging 1.00
R4271:Aspg UTSW 12 112121195 missense probably damaging 1.00
R5386:Aspg UTSW 12 112123032 missense probably benign 0.01
R5431:Aspg UTSW 12 112123412 missense probably benign 0.13
R5458:Aspg UTSW 12 112120002 missense probably damaging 0.99
R5941:Aspg UTSW 12 112113085 missense probably benign 0.02
R6003:Aspg UTSW 12 112113042 missense probably damaging 1.00
R6057:Aspg UTSW 12 112120998 missense probably damaging 0.96
R6928:Aspg UTSW 12 112126689 missense possibly damaging 0.52
R6979:Aspg UTSW 12 112120944 missense possibly damaging 0.77
R6998:Aspg UTSW 12 112112194 missense probably damaging 1.00
R7054:Aspg UTSW 12 112126390 missense probably damaging 0.98
R7060:Aspg UTSW 12 112122953 missense probably benign
R7124:Aspg UTSW 12 112122983 missense probably damaging 0.99
R7137:Aspg UTSW 12 112112198 missense possibly damaging 0.92
R7439:Aspg UTSW 12 112124821 missense possibly damaging 0.90
R7441:Aspg UTSW 12 112124821 missense possibly damaging 0.90
Z1176:Aspg UTSW 12 112113081 missense possibly damaging 0.58
Z1177:Aspg UTSW 12 112121021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGCCACACTGGGCAATGG -3'
(R):5'- GAAATATGCCTCCTTCACTGACC -3'

Sequencing Primer
(F):5'- AATGGGGCCTGCATCCC -3'
(R):5'- TGTCCCCATCAGACAAGCGTC -3'
Posted On2015-06-12