Incidental Mutation 'R4234:Mrps30'
ID321025
Institutional Source Beutler Lab
Gene Symbol Mrps30
Ensembl Gene ENSMUSG00000021731
Gene Namemitochondrial ribosomal protein S30
Synonyms2610020A16Rik, Pdcd9
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R4234 (G1)
Quality Score208
Status Not validated
Chromosome13
Chromosomal Location118378381-118387252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118386840 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 132 (D132G)
Ref Sequence ENSEMBL: ENSMUSP00000022245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022245] [ENSMUST00000181168]
Predicted Effect probably damaging
Transcript: ENSMUST00000022245
AA Change: D132G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022245
Gene: ENSMUSG00000021731
AA Change: D132G

DomainStartEndE-ValueType
Pfam:PDCD9 1 423 1.7e-180 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000181168
AA Change: S13P
SMART Domains Protein: ENSMUSP00000137680
Gene: ENSMUSG00000097411
AA Change: S13P

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
low complexity region 117 125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225170
Meta Mutation Damage Score 0.4820 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that is similar to the chicken pro-apoptotic protein p52. Transcript variants using alternative promoters or polyA sites have been mentioned in the literature but the complete description of these sequences is not available. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Ap3s1 A T 18: 46,779,200 T96S probably benign Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Aspg T A 12: 112,123,316 Y429* probably null Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
BC034090 C T 1: 155,241,580 G264D probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cerk T C 15: 86,142,788 K174E probably benign Het
Col19a1 T C 1: 24,315,395 probably null Het
Cyp2c23 G T 19: 44,029,165 T8K unknown Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dok4 T C 8: 94,865,664 E232G probably damaging Het
Dpf1 T C 7: 29,315,632 S304P probably damaging Het
Dpyd T A 3: 119,431,584 I1002N probably damaging Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm1527 G A 3: 28,914,366 G189D probably damaging Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Lix1l T A 3: 96,623,657 probably null Het
Mdc1 T C 17: 35,848,824 C658R probably benign Het
Myh15 G T 16: 49,163,042 V1507L probably benign Het
Nfe2l1 T C 11: 96,819,909 D210G probably damaging Het
Notch3 T A 17: 32,141,341 I1539F probably damaging Het
Pcdhac1 A C 18: 37,090,958 S275R probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rbbp5 A G 1: 132,484,758 T20A probably benign Het
Rere T C 4: 150,617,405 V1414A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr3 G T 2: 112,910,407 N538K probably damaging Het
Serpina3j C A 12: 104,315,186 T206K probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc27a5 C A 7: 12,988,443 C416F probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tex30 A T 1: 44,091,512 I32K possibly damaging Het
Trpc2 T C 7: 102,088,135 I752T possibly damaging Het
Wnk2 A G 13: 49,061,128 V1314A probably benign Het
Other mutations in Mrps30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Mrps30 APN 13 118380610 missense probably damaging 1.00
R0030:Mrps30 UTSW 13 118382995 missense possibly damaging 0.94
R2439:Mrps30 UTSW 13 118385272 missense probably damaging 1.00
R2764:Mrps30 UTSW 13 118384588 missense probably benign 0.03
R4030:Mrps30 UTSW 13 118380541 missense probably damaging 1.00
R4231:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4232:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4235:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4236:Mrps30 UTSW 13 118386840 missense probably damaging 0.98
R4625:Mrps30 UTSW 13 118386714 missense probably benign 0.14
R4935:Mrps30 UTSW 13 118386895 missense possibly damaging 0.82
R5363:Mrps30 UTSW 13 118387162 missense probably benign 0.39
R5986:Mrps30 UTSW 13 118384565 critical splice donor site probably null
R6566:Mrps30 UTSW 13 118387126 missense probably benign 0.00
R6681:Mrps30 UTSW 13 118380598 missense probably damaging 0.98
R6694:Mrps30 UTSW 13 118386961 missense possibly damaging 0.82
R6699:Mrps30 UTSW 13 118380598 missense probably damaging 0.98
R6700:Mrps30 UTSW 13 118380598 missense probably damaging 0.98
R6788:Mrps30 UTSW 13 118380372 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGAACCTGCAGGAAAGCTTGG -3'
(R):5'- ATTGTCCCAGAATGCCGCTG -3'

Sequencing Primer
(F):5'- TGGGAGTTCCAAGCTCACC -3'
(R):5'- TCCCAGAATGCCGCTGCTAAG -3'
Posted On2015-06-12