Incidental Mutation 'R4234:Atg14'
ID321026
Institutional Source Beutler Lab
Gene Symbol Atg14
Ensembl Gene ENSMUSG00000037526
Gene Nameautophagy related 14
SynonymsBarkor, D14Ertd436e, D14Ertd114e
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R4234 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location47540893-47570649 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47551345 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 184 (K184E)
Ref Sequence ENSEMBL: ENSMUSP00000153718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042988] [ENSMUST00000226299]
Predicted Effect probably benign
Transcript: ENSMUST00000042988
AA Change: K184E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000039047
Gene: ENSMUSG00000037526
AA Change: K184E

DomainStartEndE-ValueType
Pfam:Atg14 43 393 1.1e-79 PFAM
low complexity region 447 464 N/A INTRINSIC
low complexity region 465 480 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226299
AA Change: K184E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele following delivery of a Tat-cre exhibit increased mucin accumulation in colonic epithelial spheroids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Ap3s1 A T 18: 46,779,200 T96S probably benign Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Aspg T A 12: 112,123,316 Y429* probably null Het
BC034090 C T 1: 155,241,580 G264D probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cerk T C 15: 86,142,788 K174E probably benign Het
Col19a1 T C 1: 24,315,395 probably null Het
Cyp2c23 G T 19: 44,029,165 T8K unknown Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dok4 T C 8: 94,865,664 E232G probably damaging Het
Dpf1 T C 7: 29,315,632 S304P probably damaging Het
Dpyd T A 3: 119,431,584 I1002N probably damaging Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm1527 G A 3: 28,914,366 G189D probably damaging Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Lix1l T A 3: 96,623,657 probably null Het
Mdc1 T C 17: 35,848,824 C658R probably benign Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh15 G T 16: 49,163,042 V1507L probably benign Het
Nfe2l1 T C 11: 96,819,909 D210G probably damaging Het
Notch3 T A 17: 32,141,341 I1539F probably damaging Het
Pcdhac1 A C 18: 37,090,958 S275R probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rbbp5 A G 1: 132,484,758 T20A probably benign Het
Rere T C 4: 150,617,405 V1414A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr3 G T 2: 112,910,407 N538K probably damaging Het
Serpina3j C A 12: 104,315,186 T206K probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc27a5 C A 7: 12,988,443 C416F probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tex30 A T 1: 44,091,512 I32K possibly damaging Het
Trpc2 T C 7: 102,088,135 I752T possibly damaging Het
Wnk2 A G 13: 49,061,128 V1314A probably benign Het
Other mutations in Atg14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Atg14 APN 14 47542859 missense probably benign 0.00
IGL02513:Atg14 APN 14 47548994 missense probably benign 0.03
IGL02513:Atg14 APN 14 47545624 splice site probably benign
PIT4243001:Atg14 UTSW 14 47554574 missense possibly damaging 0.77
R1463:Atg14 UTSW 14 47548994 missense probably benign 0.03
R1479:Atg14 UTSW 14 47547239 critical splice donor site probably null
R1499:Atg14 UTSW 14 47560645 missense probably benign
R1781:Atg14 UTSW 14 47549150 critical splice acceptor site probably null
R1974:Atg14 UTSW 14 47545841 missense probably damaging 1.00
R2089:Atg14 UTSW 14 47542895 missense probably damaging 1.00
R2091:Atg14 UTSW 14 47542895 missense probably damaging 1.00
R2091:Atg14 UTSW 14 47542895 missense probably damaging 1.00
R2113:Atg14 UTSW 14 47551324 missense probably damaging 1.00
R4231:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4232:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4233:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4236:Atg14 UTSW 14 47551345 missense probably benign 0.00
R4360:Atg14 UTSW 14 47568370 missense probably benign 0.00
R4711:Atg14 UTSW 14 47545841 missense probably damaging 1.00
R4883:Atg14 UTSW 14 47551314 missense probably damaging 1.00
R5025:Atg14 UTSW 14 47545816 missense probably damaging 1.00
R5235:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5250:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5297:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5301:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5338:Atg14 UTSW 14 47568199 missense probably damaging 0.98
R5450:Atg14 UTSW 14 47551464 missense probably benign
R5475:Atg14 UTSW 14 47568336 missense possibly damaging 0.83
R5799:Atg14 UTSW 14 47547295 missense possibly damaging 0.63
R6489:Atg14 UTSW 14 47549023 missense probably damaging 0.97
R7589:Atg14 UTSW 14 47543090 missense probably benign 0.00
R7908:Atg14 UTSW 14 47568593 unclassified probably benign
Z1088:Atg14 UTSW 14 47568292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGGCCCAGTAAAAGTGC -3'
(R):5'- AGTGAAGTTCCTCTGCGTGC -3'

Sequencing Primer
(F):5'- GCCCAGTAAAAGTGCTGAAC -3'
(R):5'- TCTGCGTGCACACTCGTG -3'
Posted On2015-06-12