Incidental Mutation 'R4234:Cerk'
ID321030
Institutional Source Beutler Lab
Gene Symbol Cerk
Ensembl Gene ENSMUSG00000035891
Gene Nameceramide kinase
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4234 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location86139128-86186141 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86142788 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 174 (K174E)
Ref Sequence ENSEMBL: ENSMUSP00000119472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044332] [ENSMUST00000156546]
Predicted Effect probably benign
Transcript: ENSMUST00000044332
AA Change: K479E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000038203
Gene: ENSMUSG00000035891
AA Change: K479E

DomainStartEndE-ValueType
Blast:PH 8 126 9e-39 BLAST
Pfam:DAGK_cat 132 274 1.1e-31 PFAM
low complexity region 356 367 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150767
Predicted Effect probably benign
Transcript: ENSMUST00000156546
AA Change: K174E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000119472
Gene: ENSMUSG00000035891
AA Change: K174E

DomainStartEndE-ValueType
low complexity region 51 62 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CERK converts ceramide to ceramide 1-phosphate (C1P), a sphingolipid metabolite. Both CERK and C1P have been implicated in various cellular processes, including proliferation, apoptosis, phagocytosis, and inflammation (Kim et al., 2006 [PubMed 16488390]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced body weight, increased susceptibility to infection and decreased neutrophil numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Ap3s1 A T 18: 46,779,200 T96S probably benign Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Aspg T A 12: 112,123,316 Y429* probably null Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
BC034090 C T 1: 155,241,580 G264D probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Col19a1 T C 1: 24,315,395 probably null Het
Cyp2c23 G T 19: 44,029,165 T8K unknown Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dok4 T C 8: 94,865,664 E232G probably damaging Het
Dpf1 T C 7: 29,315,632 S304P probably damaging Het
Dpyd T A 3: 119,431,584 I1002N probably damaging Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm1527 G A 3: 28,914,366 G189D probably damaging Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Lix1l T A 3: 96,623,657 probably null Het
Mdc1 T C 17: 35,848,824 C658R probably benign Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh15 G T 16: 49,163,042 V1507L probably benign Het
Nfe2l1 T C 11: 96,819,909 D210G probably damaging Het
Notch3 T A 17: 32,141,341 I1539F probably damaging Het
Pcdhac1 A C 18: 37,090,958 S275R probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rbbp5 A G 1: 132,484,758 T20A probably benign Het
Rere T C 4: 150,617,405 V1414A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr3 G T 2: 112,910,407 N538K probably damaging Het
Serpina3j C A 12: 104,315,186 T206K probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc27a5 C A 7: 12,988,443 C416F probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tex30 A T 1: 44,091,512 I32K possibly damaging Het
Trpc2 T C 7: 102,088,135 I752T possibly damaging Het
Wnk2 A G 13: 49,061,128 V1314A probably benign Het
Other mutations in Cerk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01414:Cerk APN 15 86159142 missense probably benign 0.02
IGL01653:Cerk APN 15 86149351 nonsense probably null
IGL01732:Cerk APN 15 86146316 missense possibly damaging 0.68
IGL03107:Cerk APN 15 86142813 missense probably benign 0.00
resnick UTSW 15 86156668 unclassified probably null
IGL02837:Cerk UTSW 15 86144695 nonsense probably null
R0318:Cerk UTSW 15 86151565 missense possibly damaging 0.89
R0517:Cerk UTSW 15 86156648 missense probably damaging 1.00
R1052:Cerk UTSW 15 86149364 missense possibly damaging 0.95
R1640:Cerk UTSW 15 86149400 missense probably damaging 0.98
R2049:Cerk UTSW 15 86142808 missense probably benign
R2885:Cerk UTSW 15 86142883 missense probably damaging 1.00
R3887:Cerk UTSW 15 86149331 missense possibly damaging 0.95
R3931:Cerk UTSW 15 86155110 nonsense probably null
R4033:Cerk UTSW 15 86155027 missense possibly damaging 0.47
R4945:Cerk UTSW 15 86156601 missense probably benign 0.44
R5742:Cerk UTSW 15 86141572 missense probably damaging 1.00
R6160:Cerk UTSW 15 86142773 missense probably benign 0.43
R6309:Cerk UTSW 15 86156668 unclassified probably null
R7002:Cerk UTSW 15 86156594 missense possibly damaging 0.56
R7360:Cerk UTSW 15 86159126 missense probably damaging 1.00
X0067:Cerk UTSW 15 86146346 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ACATCTGTGAGGCACCCTTG -3'
(R):5'- TGTTGTCTGCGTCTTCACAG -3'

Sequencing Primer
(F):5'- GGGCGGAGACAGCGTTTG -3'
(R):5'- GTCTTCACAGGACCACGAGTC -3'
Posted On2015-06-12