Incidental Mutation 'R4234:Cyp2c23'
ID321038
Institutional Source Beutler Lab
Gene Symbol Cyp2c23
Ensembl Gene ENSMUSG00000025197
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 23
SynonymsCyp2c44
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4234 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location44005022-44029208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 44029165 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 8 (T8K)
Ref Sequence ENSEMBL: ENSMUSP00000148377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026211] [ENSMUST00000211830]
Predicted Effect unknown
Transcript: ENSMUST00000026211
AA Change: T8K
SMART Domains Protein: ENSMUSP00000026211
Gene: ENSMUSG00000025197
AA Change: T8K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 34 491 2.1e-152 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000211830
AA Change: T8K
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele show reduced proliferative and tubulogenic responses in lung endothelial cells, decreased tumor angiogenesis and growth of induced tumors, and high potassium-induced hypertension with decreased urinary sodium excretion and increased plasma sodium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Ahnak A T 19: 9,000,786 K90* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Ap3s1 A T 18: 46,779,200 T96S probably benign Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Aspg T A 12: 112,123,316 Y429* probably null Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
BC034090 C T 1: 155,241,580 G264D probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cerk T C 15: 86,142,788 K174E probably benign Het
Col19a1 T C 1: 24,315,395 probably null Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dok4 T C 8: 94,865,664 E232G probably damaging Het
Dpf1 T C 7: 29,315,632 S304P probably damaging Het
Dpyd T A 3: 119,431,584 I1002N probably damaging Het
Fam107b T C 2: 3,770,740 S3P possibly damaging Het
Gm1527 G A 3: 28,914,366 G189D probably damaging Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Lix1l T A 3: 96,623,657 probably null Het
Mdc1 T C 17: 35,848,824 C658R probably benign Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myh15 G T 16: 49,163,042 V1507L probably benign Het
Nfe2l1 T C 11: 96,819,909 D210G probably damaging Het
Notch3 T A 17: 32,141,341 I1539F probably damaging Het
Pcdhac1 A C 18: 37,090,958 S275R probably damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rbbp5 A G 1: 132,484,758 T20A probably benign Het
Rere T C 4: 150,617,405 V1414A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr3 G T 2: 112,910,407 N538K probably damaging Het
Serpina3j C A 12: 104,315,186 T206K probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc27a5 C A 7: 12,988,443 C416F probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tex30 A T 1: 44,091,512 I32K possibly damaging Het
Trpc2 T C 7: 102,088,135 I752T possibly damaging Het
Wnk2 A G 13: 49,061,128 V1314A probably benign Het
Other mutations in Cyp2c23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Cyp2c23 APN 19 44015073 missense possibly damaging 0.94
IGL01642:Cyp2c23 APN 19 44005556 missense probably damaging 1.00
IGL01782:Cyp2c23 APN 19 44029115 missense possibly damaging 0.77
IGL01843:Cyp2c23 APN 19 44005607 missense probably benign 0.02
IGL02902:Cyp2c23 APN 19 44021558 splice site probably benign
IGL03382:Cyp2c23 APN 19 44014932 missense probably damaging 0.99
R0196:Cyp2c23 UTSW 19 44012356 missense probably damaging 0.98
R0735:Cyp2c23 UTSW 19 44016810 missense probably damaging 1.00
R1384:Cyp2c23 UTSW 19 44013663 missense probably damaging 1.00
R1495:Cyp2c23 UTSW 19 44005508 missense probably benign 0.07
R1809:Cyp2c23 UTSW 19 44021558 splice site probably benign
R1872:Cyp2c23 UTSW 19 44005551 nonsense probably null
R2866:Cyp2c23 UTSW 19 44005446 missense probably damaging 1.00
R3801:Cyp2c23 UTSW 19 44007039 missense probably benign 0.11
R4748:Cyp2c23 UTSW 19 44016737 splice site probably null
R4948:Cyp2c23 UTSW 19 44021699 missense possibly damaging 0.49
R5101:Cyp2c23 UTSW 19 44029183 missense unknown
R5420:Cyp2c23 UTSW 19 44015664 critical splice donor site probably null
R5770:Cyp2c23 UTSW 19 44021579 missense probably damaging 0.99
R5993:Cyp2c23 UTSW 19 44012360 missense probably damaging 1.00
R6254:Cyp2c23 UTSW 19 44005463 missense probably benign 0.03
R6269:Cyp2c23 UTSW 19 44029187 start codon destroyed unknown
R6610:Cyp2c23 UTSW 19 44007081 missense probably damaging 1.00
R7344:Cyp2c23 UTSW 19 44021737 splice site probably null
R7603:Cyp2c23 UTSW 19 44014930 missense probably damaging 1.00
R8054:Cyp2c23 UTSW 19 44007116 missense probably damaging 0.99
X0065:Cyp2c23 UTSW 19 44029171 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGAGTGCCTACCTAACCTGG -3'
(R):5'- TGATCTCAGGCTCCAGCAAAC -3'

Sequencing Primer
(F):5'- TGCCTACCTAACCTGGAAGCAAC -3'
(R):5'- TCAGGCTCCAGCAAACAAACTC -3'
Posted On2015-06-12