Mutagenetix > Incidental Mutation

Incidental Mutation 'R4235:Arhgap21'

321044

Institutional Source

Beutler Lab

Gene Symbol

Arhgap21

Ensembl Gene

ENSMUSG00000036591

Gene Name

Rho GTPase activating protein 21

Synonyms

ARHGAP10, 5530401C11Rik

MMRRC Submission

041052-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.611) question?

Stock #

R4235 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20847919-20968881 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20887137 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 161 (V161A)

Ref Sequence

ENSEMBL: ENSMUSP00000133851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000140230] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000174584]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000114594
AA Change: V155A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: V155A

Domain	Start	End	E-Value	Type
PDZ	58	159	1.03e-16	SMART
low complexity region	351	362	N/A	INTRINSIC
low complexity region	445	459	N/A	INTRINSIC
low complexity region	625	635	N/A	INTRINSIC
low complexity region	911	925	N/A	INTRINSIC
PH	930	1040	2.09e-16	SMART
RhoGAP	1157	1334	3.26e-62	SMART
low complexity region	1381	1399	N/A	INTRINSIC
low complexity region	1448	1466	N/A	INTRINSIC
low complexity region	1533	1565	N/A	INTRINSIC
low complexity region	1573	1593	N/A	INTRINSIC
low complexity region	1891	1900	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140230

SMART Domains

Protein: ENSMUSP00000122271
Gene: ENSMUSG00000036591

Domain	Start	End	E-Value	Type
PDZ	65	145	3.4e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000141298
AA Change: V161A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: V161A

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000154230
AA Change: V161A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: V161A

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156142

Predicted Effect

probably damaging
Transcript: ENSMUST00000173194
AA Change: V161A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: V161A

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	347	358	N/A	INTRINSIC
low complexity region	441	455	N/A	INTRINSIC
low complexity region	621	631	N/A	INTRINSIC
low complexity region	907	921	N/A	INTRINSIC
PH	926	1036	2.09e-16	SMART
RhoGAP	1153	1330	3.26e-62	SMART
low complexity region	1377	1395	N/A	INTRINSIC
low complexity region	1444	1462	N/A	INTRINSIC
low complexity region	1529	1561	N/A	INTRINSIC
low complexity region	1569	1589	N/A	INTRINSIC
low complexity region	1887	1896	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174584

SMART Domains

Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591

Domain	Start	End	E-Value	Type
low complexity region	186	197	N/A	INTRINSIC
low complexity region	280	294	N/A	INTRINSIC
low complexity region	460	470	N/A	INTRINSIC
low complexity region	746	760	N/A	INTRINSIC
PH	765	875	2.09e-16	SMART
RhoGAP	992	1169	3.26e-62	SMART

Meta Mutation Damage Score

0.5836

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
5730596B20Rik	G	T	6: 52,178,961		probably benign	Het
9530053A07Rik	T	A	7: 28,156,648	D1953E	probably damaging	Het
Akap6	T	A	12: 53,139,671	N1289K	probably damaging	Het
Arhgef18	T	C	8: 3,450,317	I541T	possibly damaging	Het
Atp7b	A	G	8: 22,011,023	Y955H	possibly damaging	Het
Bnc2	A	G	4: 84,293,514	V231A	probably damaging	Het
Bod1l	A	G	5: 41,821,455	S839P	probably damaging	Het
Casp8	T	A	1: 58,833,698	H264Q	possibly damaging	Het
Cc2d1b	A	T	4: 108,625,352		probably benign	Het
Cpne6	A	T	14: 55,513,600		probably benign	Het
Ddx1	C	T	12: 13,223,857	V590I	possibly damaging	Het
Dgkd	T	A	1: 87,931,982	L774*	probably null	Het
Fbxl2	T	A	9: 113,989,163	N205I	probably benign	Het
Fkbp15	A	T	4: 62,336,456	I269K	probably benign	Het
Gm13023	G	C	4: 143,794,774	C320S	probably damaging	Het
Gm26678	T	C	3: 54,633,083		noncoding transcript	Het
Has1	G	T	17: 17,850,036	R208S	possibly damaging	Het
Hecw1	C	G	13: 14,317,139	A423P	probably benign	Het
Hspa12b	T	C	2: 131,139,012	V162A	probably benign	Het
Ifi208	T	G	1: 173,682,911	S211A	probably benign	Het
Ighv6-3	T	C	12: 114,391,874	E65G	probably damaging	Het
Igkv9-120	A	T	6: 68,050,333	D77V	probably benign	Het
Impg1	A	G	9: 80,345,329	L523P	probably damaging	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Kdm2a	A	G	19: 4,322,521	I932T	probably damaging	Het
Krt17	T	C	11: 100,257,868	T279A	possibly damaging	Het
Lamp1	T	C	8: 13,167,192	V67A	possibly damaging	Het
Limk1	T	C	5: 134,670,478	I142V	probably benign	Het
Mamdc2	T	C	19: 23,374,017	N182D	possibly damaging	Het
Mcpt1	G	A	14: 56,018,560		probably null	Het
Med12l	T	G	3: 59,257,223		probably null	Het
Mfsd10	G	T	5: 34,635,625	T44N	probably damaging	Het
Mrps27	T	C	13: 99,405,041	S218P	probably damaging	Het
Mrps30	T	C	13: 118,386,840	D132G	probably damaging	Het
Neil2	A	C	14: 63,191,841	M1R	probably null	Het
Nelfcd	T	C	2: 174,427,048	F587L	probably damaging	Het
Nfil3	T	C	13: 52,968,799	D23G	probably benign	Het
Nit2	T	C	16: 57,157,160	K169R	probably benign	Het
Nxt1	T	C	2: 148,675,347	S3P	probably benign	Het
Ogt	A	G	X: 101,667,525	N434D	probably damaging	Het
Olfr679	T	A	7: 105,085,787	S24T	possibly damaging	Het
Pcdhga5	A	G	18: 37,695,948	D483G	possibly damaging	Het
Ralgapa1	C	T	12: 55,640,644	R2019Q	probably damaging	Het
Rsl1	T	C	13: 67,177,162		probably null	Het
Sobp	G	A	10: 43,022,900	H230Y	probably damaging	Het
Sptan1	A	G	2: 30,026,588	E2096G	probably damaging	Het
Tie1	G	T	4: 118,478,405	S797*	probably null	Het
Tmem266	T	C	9: 55,418,107	I186T	probably damaging	Het
Tmem38b	T	C	4: 53,840,710	C66R	probably damaging	Het
Tnfaip6	T	C	2: 52,050,864	F139S	probably damaging	Het
Tnrc6a	T	C	7: 123,171,680	S898P	probably benign	Het
Trim24	A	G	6: 37,964,740	D911G	probably damaging	Het
Tyw5	T	C	1: 57,388,488		probably benign	Het
Ubr3	C	T	2: 70,016,385	Q1651*	probably null	Het
Unc13c	T	A	9: 73,530,952	I1943F	possibly damaging	Het
Usp47	T	A	7: 112,110,048	S1334T	probably damaging	Het
Vmn1r215	T	A	13: 23,075,931	V47E	probably benign	Het
Vmn1r224	T	A	17: 20,419,362	M67K	possibly damaging	Het
Wdfy3	T	A	5: 101,922,634		probably null	Het
Zfc3h1	T	C	10: 115,418,799	Y1433H	probably benign	Het

Other mutations in Arhgap21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Arhgap21	APN	2	20855700	missense	probably damaging	1.00
IGL01472:Arhgap21	APN	2	20849581	missense	probably damaging	1.00
IGL01634:Arhgap21	APN	2	20914644	missense	probably benign	0.00
IGL01766:Arhgap21	APN	2	20849637	missense	possibly damaging	0.68
IGL02097:Arhgap21	APN	2	20880002	missense	probably benign	0.39
IGL02197:Arhgap21	APN	2	20880306	missense	probably benign
IGL02264:Arhgap21	APN	2	20860039	splice site	probably null
IGL02346:Arhgap21	APN	2	20879951	splice site	probably benign
IGL02418:Arhgap21	APN	2	20880900	missense	probably damaging	1.00
IGL02605:Arhgap21	APN	2	20855588	missense	probably damaging	1.00
IGL02701:Arhgap21	APN	2	20892091	missense	probably damaging	1.00
IGL03019:Arhgap21	APN	2	20861063	missense	probably damaging	1.00
IGL03085:Arhgap21	APN	2	20914721	missense	probably benign
IGL03265:Arhgap21	APN	2	20849628	missense	probably benign	0.03
IGL03379:Arhgap21	APN	2	20880689	missense	probably benign	0.41
R0304:Arhgap21	UTSW	2	20859801	splice site	probably benign
R0363:Arhgap21	UTSW	2	20881133	missense	probably damaging	1.00
R0498:Arhgap21	UTSW	2	20863117	missense	probably damaging	1.00
R0539:Arhgap21	UTSW	2	20914799	nonsense	probably null
R0633:Arhgap21	UTSW	2	20855387	nonsense	probably null
R0905:Arhgap21	UTSW	2	20849934	missense	possibly damaging	0.88
R1550:Arhgap21	UTSW	2	20881765	nonsense	probably null
R1570:Arhgap21	UTSW	2	20880840	missense	probably benign
R1686:Arhgap21	UTSW	2	20881848	missense	probably damaging	1.00
R1746:Arhgap21	UTSW	2	20861099	missense	probably damaging	0.99
R1864:Arhgap21	UTSW	2	20861204	missense	probably damaging	1.00
R1865:Arhgap21	UTSW	2	20861204	missense	probably damaging	1.00
R2209:Arhgap21	UTSW	2	20849520	missense	probably damaging	1.00
R2211:Arhgap21	UTSW	2	20881640	missense	possibly damaging	0.56
R2276:Arhgap21	UTSW	2	20863226	missense	possibly damaging	0.94
R2277:Arhgap21	UTSW	2	20863226	missense	possibly damaging	0.94
R2279:Arhgap21	UTSW	2	20863226	missense	possibly damaging	0.94
R2336:Arhgap21	UTSW	2	20880051	missense	probably damaging	1.00
R2516:Arhgap21	UTSW	2	20854998	missense	probably damaging	1.00
R3722:Arhgap21	UTSW	2	20850291	missense	probably damaging	1.00
R3877:Arhgap21	UTSW	2	20859906	missense	probably damaging	0.99
R4017:Arhgap21	UTSW	2	20892104	missense	probably benign	0.10
R4232:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4233:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4234:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4236:Arhgap21	UTSW	2	20887137	missense	probably damaging	1.00
R4434:Arhgap21	UTSW	2	20967335	missense	probably benign
R4686:Arhgap21	UTSW	2	20863222	missense	probably damaging	1.00
R4817:Arhgap21	UTSW	2	20850156	missense	probably benign
R4834:Arhgap21	UTSW	2	20865319	missense	probably damaging	1.00
R4845:Arhgap21	UTSW	2	20881187	missense	probably damaging	0.99
R4889:Arhgap21	UTSW	2	20880468	missense	probably benign	0.10
R4904:Arhgap21	UTSW	2	20850061	missense	probably benign	0.00
R4911:Arhgap21	UTSW	2	20858989	missense	probably damaging	1.00
R4994:Arhgap21	UTSW	2	20849890	missense	probably benign	0.00
R5067:Arhgap21	UTSW	2	20880037	missense	probably damaging	1.00
R5086:Arhgap21	UTSW	2	20848834	missense	probably benign	0.00
R5281:Arhgap21	UTSW	2	20849316	missense	probably damaging	1.00
R5364:Arhgap21	UTSW	2	20849722	missense	probably damaging	1.00
R5420:Arhgap21	UTSW	2	20881086	missense	probably damaging	0.99
R5476:Arhgap21	UTSW	2	20880686	missense	probably benign	0.06
R5831:Arhgap21	UTSW	2	20863213	missense	probably damaging	1.00
R5949:Arhgap21	UTSW	2	20849041	missense	probably damaging	0.97
R5994:Arhgap21	UTSW	2	20881376	missense	possibly damaging	0.78
R6014:Arhgap21	UTSW	2	20881805	missense	probably damaging	1.00
R6739:Arhgap21	UTSW	2	20880732	missense	possibly damaging	0.94
R6817:Arhgap21	UTSW	2	20880296	missense	probably benign	0.23
R6821:Arhgap21	UTSW	2	20848848	missense	probably benign
R6844:Arhgap21	UTSW	2	20881305	missense	probably benign	0.00
R6870:Arhgap21	UTSW	2	20880510	missense	probably damaging	1.00
R6891:Arhgap21	UTSW	2	20850331	missense	probably damaging	0.97
R7011:Arhgap21	UTSW	2	20848878	missense	possibly damaging	0.65
R7144:Arhgap21	UTSW	2	20865387	missense	probably benign
R7237:Arhgap21	UTSW	2	20849972	nonsense	probably null
R7261:Arhgap21	UTSW	2	20880366	missense	probably benign
R7558:Arhgap21	UTSW	2	20855610	missense	probably damaging	1.00
R7566:Arhgap21	UTSW	2	20912291	missense	probably benign	0.17
R7738:Arhgap21	UTSW	2	20849479	missense	probably damaging	1.00
R7738:Arhgap21	UTSW	2	20850358	missense	probably damaging	1.00
R7820:Arhgap21	UTSW	2	20863172	missense	probably damaging	1.00
R7822:Arhgap21	UTSW	2	20880713	missense	possibly damaging	0.80
R7965:Arhgap21	UTSW	2	20849196	missense	probably damaging	1.00
R7986:Arhgap21	UTSW	2	20863156	missense	probably damaging	1.00
R8028:Arhgap21	UTSW	2	20880405	missense	probably benign	0.02
R8209:Arhgap21	UTSW	2	20871745	missense	probably damaging	1.00
R8226:Arhgap21	UTSW	2	20871745	missense	probably damaging	1.00
R8251:Arhgap21	UTSW	2	20849410	missense	probably benign
R8486:Arhgap21	UTSW	2	20860425	missense	probably damaging	1.00
R8487:Arhgap21	UTSW	2	20881305	missense	probably benign	0.08
R8508:Arhgap21	UTSW	2	20854180	missense	probably benign	0.17
R8835:Arhgap21	UTSW	2	20967333	nonsense	probably null
R9140:Arhgap21	UTSW	2	20881214	missense	probably damaging	1.00
R9190:Arhgap21	UTSW	2	20854172	missense	probably null	0.04
R9204:Arhgap21	UTSW	2	20881005	missense	probably damaging	1.00
R9227:Arhgap21	UTSW	2	20855658	missense	possibly damaging	0.92
R9230:Arhgap21	UTSW	2	20855658	missense	possibly damaging	0.92
R9308:Arhgap21	UTSW	2	20849250	missense	probably damaging	0.99
R9374:Arhgap21	UTSW	2	20881586	missense	probably damaging	1.00
R9449:Arhgap21	UTSW	2	20880653	missense	probably benign
R9454:Arhgap21	UTSW	2	20865342	missense	probably damaging	0.99
R9499:Arhgap21	UTSW	2	20881586	missense	probably damaging	1.00
R9544:Arhgap21	UTSW	2	20854127	missense	possibly damaging	0.73
R9552:Arhgap21	UTSW	2	20881586	missense	probably damaging	1.00
R9567:Arhgap21	UTSW	2	20892142	missense	possibly damaging	0.94
R9588:Arhgap21	UTSW	2	20854127	missense	possibly damaging	0.73
R9749:Arhgap21	UTSW	2	20849215	missense	probably benign	0.00
Z1191:Arhgap21	UTSW	2	20881472	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- GTGGACAACAATCTGTCTCTTG -3'
(R):5'- AATTAGTGGCACGTTGTAATGAGC -3'

Sequencing Primer
(F):5'- AGTGAACCAGGAGGGTTT -3'
(R):5'- CACGTTGTAATGAGCCGTACGATC -3'

Posted On

2015-06-12