Incidental Mutation 'R4235:Nelfcd'
ID321050
Institutional Source Beutler Lab
Gene Symbol Nelfcd
Ensembl Gene ENSMUSG00000016253
Gene Namenegative elongation factor complex member C/D, Th1l
Synonymstrihydrophobin 1, Th1l, 2410003I03Rik
MMRRC Submission 041052-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R4235 (G1)
Quality Score217
Status Validated
Chromosome2
Chromosomal Location174415804-174427502 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 174427048 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 587 (F587L)
Ref Sequence ENSEMBL: ENSMUSP00000104703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016397] [ENSMUST00000016400] [ENSMUST00000109075]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016397
AA Change: F603L

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000016397
Gene: ENSMUSG00000016253
AA Change: F603L

DomainStartEndE-ValueType
Pfam:TH1 11 604 6.5e-276 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000016400
SMART Domains Protein: ENSMUSP00000016400
Gene: ENSMUSG00000016256

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pept_C1 64 301 5.46e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109075
AA Change: F587L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104703
Gene: ENSMUSG00000016253
AA Change: F587L

DomainStartEndE-ValueType
Pfam:TH1 10 590 5.6e-303 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143683
Meta Mutation Damage Score 0.1271 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NELF complex of proteins interacts with the DSIF protein complex to repress transcriptional elongation by RNA polymerase II. The protein encoded by this gene is an essential part of the NELF complex. Alternative translation initiation site usage results in the formation of two isoforms with different N-termini. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
5730596B20Rik G T 6: 52,178,961 probably benign Het
9530053A07Rik T A 7: 28,156,648 D1953E probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Bnc2 A G 4: 84,293,514 V231A probably damaging Het
Bod1l A G 5: 41,821,455 S839P probably damaging Het
Casp8 T A 1: 58,833,698 H264Q possibly damaging Het
Cc2d1b A T 4: 108,625,352 probably benign Het
Cpne6 A T 14: 55,513,600 probably benign Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dgkd T A 1: 87,931,982 L774* probably null Het
Fbxl2 T A 9: 113,989,163 N205I probably benign Het
Fkbp15 A T 4: 62,336,456 I269K probably benign Het
Gm13023 G C 4: 143,794,774 C320S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Has1 G T 17: 17,850,036 R208S possibly damaging Het
Hecw1 C G 13: 14,317,139 A423P probably benign Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Ifi208 T G 1: 173,682,911 S211A probably benign Het
Ighv6-3 T C 12: 114,391,874 E65G probably damaging Het
Igkv9-120 A T 6: 68,050,333 D77V probably benign Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm2a A G 19: 4,322,521 I932T probably damaging Het
Krt17 T C 11: 100,257,868 T279A possibly damaging Het
Lamp1 T C 8: 13,167,192 V67A possibly damaging Het
Limk1 T C 5: 134,670,478 I142V probably benign Het
Mamdc2 T C 19: 23,374,017 N182D possibly damaging Het
Mcpt1 G A 14: 56,018,560 probably null Het
Med12l T G 3: 59,257,223 probably null Het
Mfsd10 G T 5: 34,635,625 T44N probably damaging Het
Mrps27 T C 13: 99,405,041 S218P probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Neil2 A C 14: 63,191,841 M1R probably null Het
Nfil3 T C 13: 52,968,799 D23G probably benign Het
Nit2 T C 16: 57,157,160 K169R probably benign Het
Nxt1 T C 2: 148,675,347 S3P probably benign Het
Ogt A G X: 101,667,525 N434D probably damaging Het
Olfr679 T A 7: 105,085,787 S24T possibly damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rsl1 T C 13: 67,177,162 probably null Het
Sobp G A 10: 43,022,900 H230Y probably damaging Het
Sptan1 A G 2: 30,026,588 E2096G probably damaging Het
Tie1 G T 4: 118,478,405 S797* probably null Het
Tmem266 T C 9: 55,418,107 I186T probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tnfaip6 T C 2: 52,050,864 F139S probably damaging Het
Tnrc6a T C 7: 123,171,680 S898P probably benign Het
Trim24 A G 6: 37,964,740 D911G probably damaging Het
Tyw5 T C 1: 57,388,488 probably benign Het
Ubr3 C T 2: 70,016,385 Q1651* probably null Het
Unc13c T A 9: 73,530,952 I1943F possibly damaging Het
Usp47 T A 7: 112,110,048 S1334T probably damaging Het
Vmn1r215 T A 13: 23,075,931 V47E probably benign Het
Vmn1r224 T A 17: 20,419,362 M67K possibly damaging Het
Wdfy3 T A 5: 101,922,634 probably null Het
Zfc3h1 T C 10: 115,418,799 Y1433H probably benign Het
Other mutations in Nelfcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Nelfcd APN 2 174423515 splice site probably benign
IGL02175:Nelfcd APN 2 174420382 missense probably benign 0.01
IGL02955:Nelfcd APN 2 174422598 missense probably damaging 0.98
IGL03193:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03194:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03203:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03217:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03237:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03273:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03278:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03289:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03365:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03398:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03405:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03407:Nelfcd APN 2 174426832 missense possibly damaging 0.87
R0593:Nelfcd UTSW 2 174423430 missense probably benign 0.00
R0751:Nelfcd UTSW 2 174423014 missense probably benign 0.03
R1852:Nelfcd UTSW 2 174423978 splice site probably null
R2040:Nelfcd UTSW 2 174420082 missense probably damaging 1.00
R3606:Nelfcd UTSW 2 174426544 missense probably benign 0.10
R3716:Nelfcd UTSW 2 174423005 missense possibly damaging 0.51
R4607:Nelfcd UTSW 2 174423162 missense probably benign 0.01
R4775:Nelfcd UTSW 2 174426576 missense probably damaging 0.96
R5104:Nelfcd UTSW 2 174426366 missense probably benign 0.10
R5859:Nelfcd UTSW 2 174427063 makesense probably null
R6025:Nelfcd UTSW 2 174426818 missense probably damaging 1.00
R6104:Nelfcd UTSW 2 174423457 missense probably damaging 0.99
R6280:Nelfcd UTSW 2 174415946 missense probably benign
R7249:Nelfcd UTSW 2 174423206 critical splice donor site probably null
R7382:Nelfcd UTSW 2 174423383 missense probably benign 0.00
R7532:Nelfcd UTSW 2 174426396 missense probably damaging 1.00
R7545:Nelfcd UTSW 2 174423978 splice site probably null
R7766:Nelfcd UTSW 2 174426832 missense possibly damaging 0.87
Z1088:Nelfcd UTSW 2 174426494 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCTTGGAAAATGACAGCATCGC -3'
(R):5'- TGGGATGTGACATGTAGCAC -3'

Sequencing Primer
(F):5'- GACAGCATCGCGGGCAC -3'
(R):5'- TCTGCCACAGAAGCTACCTTTGAG -3'
Posted On2015-06-12