Mutagenetix > Incidental Mutation

Incidental Mutation 'R4235:Med12l'

321052

Institutional Source

Beutler Lab

Gene Symbol

Med12l

Ensembl Gene

ENSMUSG00000056476

Gene Name

mediator complex subunit 12-like

Synonyms

MMRRC Submission

041052-MU

Accession Numbers

NCBI RefSeq: NM_177855.3; MGI: 2139916

Essential gene?

Possibly non essential (E-score: 0.257) question?

Stock #

R4235 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59005825-59318682 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to G at 59257223 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000142903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000040325] [ENSMUST00000050360] [ENSMUST00000164225] [ENSMUST00000164225] [ENSMUST00000199609] [ENSMUST00000199659] [ENSMUST00000199659]

AlphaFold

Q8BQM9

Predicted Effect

probably null
Transcript: ENSMUST00000040325

SMART Domains

Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	282	730	2.6e-207	PFAM
low complexity region	744	758	N/A	INTRINSIC
low complexity region	853	872	N/A	INTRINSIC
low complexity region	1455	1466	N/A	INTRINSIC
low complexity region	1728	1742	N/A	INTRINSIC
low complexity region	1769	1783	N/A	INTRINSIC
Pfam:Med12-PQL	1803	2029	2.3e-14	PFAM
low complexity region	2055	2076	N/A	INTRINSIC
low complexity region	2083	2101	N/A	INTRINSIC
low complexity region	2116	2136	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000040325

SMART Domains

Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	282	730	2.6e-207	PFAM
low complexity region	744	758	N/A	INTRINSIC
low complexity region	853	872	N/A	INTRINSIC
low complexity region	1455	1466	N/A	INTRINSIC
low complexity region	1728	1742	N/A	INTRINSIC
low complexity region	1769	1783	N/A	INTRINSIC
Pfam:Med12-PQL	1803	2029	2.3e-14	PFAM
low complexity region	2055	2076	N/A	INTRINSIC
low complexity region	2083	2101	N/A	INTRINSIC
low complexity region	2116	2136	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000050360

SMART Domains

Protein: ENSMUSP00000051353
Gene: ENSMUSG00000036353

Domain	Start	End	E-Value	Type
Pfam:7tm_1	48	304	1.3e-40	PFAM
low complexity region	322	335	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000164225

SMART Domains

Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	283	765	5e-187	PFAM
low complexity region	779	793	N/A	INTRINSIC
low complexity region	888	907	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1763	1777	N/A	INTRINSIC
low complexity region	1804	1818	N/A	INTRINSIC
Pfam:Med12-PQL	1840	2063	9.7e-66	PFAM
low complexity region	2090	2111	N/A	INTRINSIC
low complexity region	2118	2136	N/A	INTRINSIC
low complexity region	2151	2171	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000164225

SMART Domains

Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	283	765	5e-187	PFAM
low complexity region	779	793	N/A	INTRINSIC
low complexity region	888	907	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1763	1777	N/A	INTRINSIC
low complexity region	1804	1818	N/A	INTRINSIC
Pfam:Med12-PQL	1840	2063	9.7e-66	PFAM
low complexity region	2090	2111	N/A	INTRINSIC
low complexity region	2118	2136	N/A	INTRINSIC
low complexity region	2151	2171	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197374

Predicted Effect

probably benign
Transcript: ENSMUST00000199609

SMART Domains

Protein: ENSMUSP00000143521
Gene: ENSMUSG00000036353

Domain	Start	End	E-Value	Type
Pfam:7tm_1	23	304	1.5e-31	PFAM
low complexity region	322	335	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000199659

SMART Domains

Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	282	765	5.5e-209	PFAM
low complexity region	779	793	N/A	INTRINSIC
low complexity region	888	907	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1761	1775	N/A	INTRINSIC
low complexity region	1802	1816	N/A	INTRINSIC
Pfam:Med12-PQL	1836	2062	1.7e-15	PFAM
low complexity region	2088	2130	N/A	INTRINSIC
low complexity region	2144	2164	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000199659

SMART Domains

Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

Domain	Start	End	E-Value	Type
Med12	101	161	1.71e-24	SMART
low complexity region	216	224	N/A	INTRINSIC
low complexity region	269	278	N/A	INTRINSIC
Pfam:Med12-LCEWAV	282	765	5.5e-209	PFAM
low complexity region	779	793	N/A	INTRINSIC
low complexity region	888	907	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1761	1775	N/A	INTRINSIC
low complexity region	1802	1816	N/A	INTRINSIC
Pfam:Med12-PQL	1836	2062	1.7e-15	PFAM
low complexity region	2088	2130	N/A	INTRINSIC
low complexity region	2144	2164	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the Mediator complex, which is involved in transcriptional coactivation of nearly all RNA polymerase II-dependent genes. The Mediator complex links gene-specific transcriptional activators with the basal transcription machinery. [provided by RefSeq, May 2010]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
5730596B20Rik	G	T	6: 52,178,961		probably benign	Het
9530053A07Rik	T	A	7: 28,156,648	D1953E	probably damaging	Het
Akap6	T	A	12: 53,139,671	N1289K	probably damaging	Het
Arhgap21	A	G	2: 20,887,137	V161A	probably damaging	Het
Arhgef18	T	C	8: 3,450,317	I541T	possibly damaging	Het
Atp7b	A	G	8: 22,011,023	Y955H	possibly damaging	Het
Bnc2	A	G	4: 84,293,514	V231A	probably damaging	Het
Bod1l	A	G	5: 41,821,455	S839P	probably damaging	Het
Casp8	T	A	1: 58,833,698	H264Q	possibly damaging	Het
Cc2d1b	A	T	4: 108,625,352		probably benign	Het
Cpne6	A	T	14: 55,513,600		probably benign	Het
Ddx1	C	T	12: 13,223,857	V590I	possibly damaging	Het
Dgkd	T	A	1: 87,931,982	L774*	probably null	Het
Fbxl2	T	A	9: 113,989,163	N205I	probably benign	Het
Fkbp15	A	T	4: 62,336,456	I269K	probably benign	Het
Gm13023	G	C	4: 143,794,774	C320S	probably damaging	Het
Gm26678	T	C	3: 54,633,083		noncoding transcript	Het
Has1	G	T	17: 17,850,036	R208S	possibly damaging	Het
Hecw1	C	G	13: 14,317,139	A423P	probably benign	Het
Hspa12b	T	C	2: 131,139,012	V162A	probably benign	Het
Ifi208	T	G	1: 173,682,911	S211A	probably benign	Het
Ighv6-3	T	C	12: 114,391,874	E65G	probably damaging	Het
Igkv9-120	A	T	6: 68,050,333	D77V	probably benign	Het
Impg1	A	G	9: 80,345,329	L523P	probably damaging	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Kdm2a	A	G	19: 4,322,521	I932T	probably damaging	Het
Krt17	T	C	11: 100,257,868	T279A	possibly damaging	Het
Lamp1	T	C	8: 13,167,192	V67A	possibly damaging	Het
Limk1	T	C	5: 134,670,478	I142V	probably benign	Het
Mamdc2	T	C	19: 23,374,017	N182D	possibly damaging	Het
Mcpt1	G	A	14: 56,018,560		probably null	Het
Mfsd10	G	T	5: 34,635,625	T44N	probably damaging	Het
Mrps27	T	C	13: 99,405,041	S218P	probably damaging	Het
Mrps30	T	C	13: 118,386,840	D132G	probably damaging	Het
Neil2	A	C	14: 63,191,841	M1R	probably null	Het
Nelfcd	T	C	2: 174,427,048	F587L	probably damaging	Het
Nfil3	T	C	13: 52,968,799	D23G	probably benign	Het
Nit2	T	C	16: 57,157,160	K169R	probably benign	Het
Nxt1	T	C	2: 148,675,347	S3P	probably benign	Het
Ogt	A	G	X: 101,667,525	N434D	probably damaging	Het
Olfr679	T	A	7: 105,085,787	S24T	possibly damaging	Het
Pcdhga5	A	G	18: 37,695,948	D483G	possibly damaging	Het
Ralgapa1	C	T	12: 55,640,644	R2019Q	probably damaging	Het
Rsl1	T	C	13: 67,177,162		probably null	Het
Sobp	G	A	10: 43,022,900	H230Y	probably damaging	Het
Sptan1	A	G	2: 30,026,588	E2096G	probably damaging	Het
Tie1	G	T	4: 118,478,405	S797*	probably null	Het
Tmem266	T	C	9: 55,418,107	I186T	probably damaging	Het
Tmem38b	T	C	4: 53,840,710	C66R	probably damaging	Het
Tnfaip6	T	C	2: 52,050,864	F139S	probably damaging	Het
Tnrc6a	T	C	7: 123,171,680	S898P	probably benign	Het
Trim24	A	G	6: 37,964,740	D911G	probably damaging	Het
Tyw5	T	C	1: 57,388,488		probably benign	Het
Ubr3	C	T	2: 70,016,385	Q1651*	probably null	Het
Unc13c	T	A	9: 73,530,952	I1943F	possibly damaging	Het
Usp47	T	A	7: 112,110,048	S1334T	probably damaging	Het
Vmn1r215	T	A	13: 23,075,931	V47E	probably benign	Het
Vmn1r224	T	A	17: 20,419,362	M67K	possibly damaging	Het
Wdfy3	T	A	5: 101,922,634		probably null	Het
Zfc3h1	T	C	10: 115,418,799	Y1433H	probably benign	Het

Other mutations in Med12l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Med12l	APN	3	59042336	missense	probably damaging	0.98
IGL00561:Med12l	APN	3	59227824	missense	probably benign
IGL00974:Med12l	APN	3	59083014	missense	probably damaging	1.00
IGL01024:Med12l	APN	3	59073341	missense	probably damaging	1.00
IGL01094:Med12l	APN	3	59093655	missense	probably damaging	0.99
IGL01134:Med12l	APN	3	59042275	missense	possibly damaging	0.91
IGL01535:Med12l	APN	3	59262259	missense	probably damaging	1.00
IGL01653:Med12l	APN	3	59261893	missense	probably damaging	1.00
IGL01735:Med12l	APN	3	59263254	missense	probably damaging	1.00
IGL01972:Med12l	APN	3	59261893	missense	probably damaging	1.00
IGL02005:Med12l	APN	3	59244947	missense	probably damaging	1.00
IGL02098:Med12l	APN	3	59275855	missense	possibly damaging	0.92
IGL02115:Med12l	APN	3	59068319	missense	probably benign	0.00
IGL02231:Med12l	APN	3	59245882	missense	probably damaging	1.00
IGL02259:Med12l	APN	3	59245843	missense	probably damaging	1.00
IGL02369:Med12l	APN	3	59257373	missense	probably benign	0.00
IGL02424:Med12l	APN	3	59092722	missense	probably benign	0.21
IGL02501:Med12l	APN	3	59261976	missense	possibly damaging	0.71
IGL02525:Med12l	APN	3	59068368	missense	probably benign	0.01
IGL02530:Med12l	APN	3	59077089	missense	probably damaging	1.00
IGL02735:Med12l	APN	3	59093646	missense	probably damaging	1.00
IGL02865:Med12l	APN	3	59294292	missense	probably damaging	1.00
IGL03183:Med12l	APN	3	59037555	splice site	probably null
IGL03264:Med12l	APN	3	59301367	nonsense	probably null
FR4304:Med12l	UTSW	3	59275982	small insertion	probably benign
FR4340:Med12l	UTSW	3	59275985	small insertion	probably benign
FR4342:Med12l	UTSW	3	59275988	small insertion	probably benign
FR4342:Med12l	UTSW	3	59275994	small insertion	probably benign
FR4449:Med12l	UTSW	3	59275963	nonsense	probably null
FR4548:Med12l	UTSW	3	59275982	small insertion	probably benign
FR4589:Med12l	UTSW	3	59275956	small insertion	probably benign
FR4976:Med12l	UTSW	3	59275977	small insertion	probably benign
P0007:Med12l	UTSW	3	59091395	splice site	probably benign
P0045:Med12l	UTSW	3	59091535	missense	probably damaging	0.99
R0030:Med12l	UTSW	3	59248655	missense	probably damaging	1.00
R0030:Med12l	UTSW	3	59248655	missense	probably damaging	1.00
R0148:Med12l	UTSW	3	59037654	missense	probably damaging	1.00
R0325:Med12l	UTSW	3	59077059	missense	possibly damaging	0.88
R0330:Med12l	UTSW	3	59227702	missense	probably damaging	1.00
R0388:Med12l	UTSW	3	59093504	splice site	probably benign
R0542:Med12l	UTSW	3	59042401	missense	probably damaging	1.00
R0624:Med12l	UTSW	3	59037702	nonsense	probably null
R0625:Med12l	UTSW	3	59247437	missense	probably damaging	1.00
R0671:Med12l	UTSW	3	59264929	missense	probably damaging	1.00
R0706:Med12l	UTSW	3	59261980	missense	probably damaging	1.00
R0785:Med12l	UTSW	3	59260832	missense	probably damaging	1.00
R1054:Med12l	UTSW	3	59248651	missense	probably damaging	0.99
R1102:Med12l	UTSW	3	59244836	missense	probably damaging	0.99
R1391:Med12l	UTSW	3	59037738	missense	probably benign	0.00
R1501:Med12l	UTSW	3	59260835	critical splice donor site	probably null
R1544:Med12l	UTSW	3	59265240	missense	possibly damaging	0.71
R1662:Med12l	UTSW	3	59093617	missense	probably damaging	1.00
R1670:Med12l	UTSW	3	59275958	small insertion	probably benign
R1839:Med12l	UTSW	3	59068319	missense	probably benign
R1854:Med12l	UTSW	3	59260772	missense	probably damaging	1.00
R2045:Med12l	UTSW	3	59262310	nonsense	probably null
R2070:Med12l	UTSW	3	59244905	missense	probably damaging	1.00
R2132:Med12l	UTSW	3	59265282	splice site	probably null
R2290:Med12l	UTSW	3	59244938	missense	probably damaging	1.00
R2325:Med12l	UTSW	3	59232454	missense	probably damaging	0.99
R2352:Med12l	UTSW	3	59240692	missense	probably damaging	1.00
R2484:Med12l	UTSW	3	59297838	missense	probably benign	0.18
R2906:Med12l	UTSW	3	59257082	missense	probably damaging	1.00
R3735:Med12l	UTSW	3	59091495	missense	probably damaging	1.00
R3736:Med12l	UTSW	3	59091495	missense	probably damaging	1.00
R3774:Med12l	UTSW	3	59247942	missense	probably damaging	0.97
R3957:Med12l	UTSW	3	59073168	missense	probably damaging	0.99
R4020:Med12l	UTSW	3	59247942	missense	probably damaging	0.97
R4087:Med12l	UTSW	3	59297921	missense	probably benign	0.00
R4231:Med12l	UTSW	3	59257223	splice site	probably null
R4233:Med12l	UTSW	3	59257223	splice site	probably null
R4236:Med12l	UTSW	3	59257223	splice site	probably null
R4327:Med12l	UTSW	3	59265267	missense	probably benign	0.01
R4328:Med12l	UTSW	3	59265267	missense	probably benign	0.01
R4346:Med12l	UTSW	3	59031555	missense	probably damaging	1.00
R4543:Med12l	UTSW	3	59091508	missense	probably damaging	1.00
R4559:Med12l	UTSW	3	59007102	critical splice donor site	probably null
R4776:Med12l	UTSW	3	59233212	missense	probably damaging	1.00
R4877:Med12l	UTSW	3	59244793	missense	probably damaging	1.00
R4983:Med12l	UTSW	3	59261929	missense	probably damaging	1.00
R5114:Med12l	UTSW	3	59259688	missense	possibly damaging	0.85
R5125:Med12l	UTSW	3	59267214	missense	possibly damaging	0.83
R5230:Med12l	UTSW	3	59245788	missense	probably damaging	1.00
R5407:Med12l	UTSW	3	59258201	missense	probably damaging	1.00
R5426:Med12l	UTSW	3	59248722	missense	probably damaging	0.98
R5439:Med12l	UTSW	3	59263213	missense	probably null	1.00
R5449:Med12l	UTSW	3	59259706	missense	probably damaging	1.00
R5596:Med12l	UTSW	3	59252350	missense	probably benign	0.45
R5716:Med12l	UTSW	3	59301377	critical splice donor site	probably null
R5833:Med12l	UTSW	3	59265226	missense	possibly damaging	0.95
R5883:Med12l	UTSW	3	59091468	missense	probably damaging	1.00
R6264:Med12l	UTSW	3	59256002	missense	probably damaging	1.00
R6269:Med12l	UTSW	3	59227822	missense	probably damaging	1.00
R6394:Med12l	UTSW	3	59235087	missense	probably damaging	1.00
R6400:Med12l	UTSW	3	59247911	missense	probably damaging	1.00
R6475:Med12l	UTSW	3	59257079	missense	probably damaging	1.00
R6489:Med12l	UTSW	3	59257407	missense	probably damaging	0.99
R6654:Med12l	UTSW	3	59262292	missense	probably damaging	1.00
R6881:Med12l	UTSW	3	59267165	missense	probably benign	0.00
R7110:Med12l	UTSW	3	59262224	missense	possibly damaging	0.92
R7134:Med12l	UTSW	3	59093759	nonsense	probably null
R7137:Med12l	UTSW	3	59258254	missense	probably damaging	1.00
R7159:Med12l	UTSW	3	59276017	missense	probably benign
R7341:Med12l	UTSW	3	59042403	missense	possibly damaging	0.53
R7349:Med12l	UTSW	3	59258325	missense	probably damaging	1.00
R7413:Med12l	UTSW	3	59091550	missense	probably benign	0.00
R7495:Med12l	UTSW	3	59244773	missense	probably damaging	1.00
R7678:Med12l	UTSW	3	59076720	missense	probably damaging	1.00
R7697:Med12l	UTSW	3	59240657	missense	probably damaging	1.00
R7714:Med12l	UTSW	3	59093586	missense	probably benign	0.17
R7725:Med12l	UTSW	3	59255992	missense	probably damaging	1.00
R7846:Med12l	UTSW	3	59264934	missense	probably damaging	1.00
R7852:Med12l	UTSW	3	59247911	missense	probably damaging	1.00
R8080:Med12l	UTSW	3	59265186	missense	probably damaging	1.00
R8181:Med12l	UTSW	3	59261968	missense	probably damaging	1.00
R8223:Med12l	UTSW	3	59086363	missense	possibly damaging	0.79
R8560:Med12l	UTSW	3	59037605	missense	probably damaging	1.00
R8708:Med12l	UTSW	3	59252330	missense	probably benign	0.00
R8865:Med12l	UTSW	3	59071882	missense	probably benign
R8947:Med12l	UTSW	3	59077022	splice site	probably benign
R8976:Med12l	UTSW	3	59275908	missense	probably damaging	0.99
R9016:Med12l	UTSW	3	59255873	missense	probably damaging	0.96
R9183:Med12l	UTSW	3	59077077	missense	probably damaging	1.00
R9487:Med12l	UTSW	3	59247932	missense	probably benign
R9526:Med12l	UTSW	3	59076786	missense	probably damaging	0.96
R9802:Med12l	UTSW	3	59261925	missense	probably damaging	1.00
RF004:Med12l	UTSW	3	59275969	small insertion	probably benign
RF011:Med12l	UTSW	3	59275980	small insertion	probably benign
RF013:Med12l	UTSW	3	59275966	small insertion	probably benign
RF020:Med12l	UTSW	3	59275958	small insertion	probably benign
RF021:Med12l	UTSW	3	59073290	missense	probably benign	0.19
RF027:Med12l	UTSW	3	59275967	small insertion	probably benign
RF027:Med12l	UTSW	3	59275981	small insertion	probably benign
RF030:Med12l	UTSW	3	59275989	small insertion	probably benign
RF032:Med12l	UTSW	3	59275981	small insertion	probably benign
RF032:Med12l	UTSW	3	59275985	small insertion	probably benign
RF032:Med12l	UTSW	3	59275989	small insertion	probably benign
RF033:Med12l	UTSW	3	59275981	small insertion	probably benign
RF033:Med12l	UTSW	3	59275987	small insertion	probably benign
RF033:Med12l	UTSW	3	59275995	small insertion	probably benign
RF037:Med12l	UTSW	3	59275956	small insertion	probably benign
RF040:Med12l	UTSW	3	59275967	small insertion	probably benign
RF040:Med12l	UTSW	3	59275989	small insertion	probably benign
RF041:Med12l	UTSW	3	59275985	small insertion	probably benign
RF041:Med12l	UTSW	3	59275995	small insertion	probably benign
RF042:Med12l	UTSW	3	59275956	small insertion	probably benign
RF042:Med12l	UTSW	3	59275967	small insertion	probably benign
RF042:Med12l	UTSW	3	59275981	small insertion	probably benign
RF042:Med12l	UTSW	3	59275995	small insertion	probably benign
RF049:Med12l	UTSW	3	59275969	small insertion	probably benign
RF050:Med12l	UTSW	3	59275973	small insertion	probably benign
RF053:Med12l	UTSW	3	59275993	small insertion	probably benign
RF055:Med12l	UTSW	3	59275983	small insertion	probably benign
RF056:Med12l	UTSW	3	59275993	small insertion	probably benign
RF057:Med12l	UTSW	3	59275980	small insertion	probably benign
RF063:Med12l	UTSW	3	59275958	small insertion	probably benign
RF063:Med12l	UTSW	3	59275973	small insertion	probably benign
X0062:Med12l	UTSW	3	59233179	missense	probably damaging	1.00
Z1176:Med12l	UTSW	3	59091417	missense	probably damaging	0.98
Z1176:Med12l	UTSW	3	59244943	missense	probably damaging	1.00
Z1176:Med12l	UTSW	3	59296117	missense	probably benign	0.00
Z1177:Med12l	UTSW	3	59247875	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTGGACGTTGAGACAGTC -3'
(R):5'- TATGAAATATCAACGGTAGCCCAAC -3'

Sequencing Primer
(F):5'- ACGTTGAGACAGTCCTGGC -3'
(R):5'- ATTCCATTCTGTCTTGTGCTACTTGG -3'

Posted On

2015-06-12