Incidental Mutation 'R4235:Tmem38b'
ID321053
Institutional Source Beutler Lab
Gene Symbol Tmem38b
Ensembl Gene ENSMUSG00000028420
Gene Nametransmembrane protein 38B
Synonyms1600017F22Rik, TRIC-B, D4Ertd89e
MMRRC Submission 041052-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4235 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location53826045-53862019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53840710 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 66 (C66R)
Ref Sequence ENSEMBL: ENSMUSP00000030127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030127] [ENSMUST00000144167]
Predicted Effect probably damaging
Transcript: ENSMUST00000030127
AA Change: C66R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030127
Gene: ENSMUSG00000028420
AA Change: C66R

DomainStartEndE-ValueType
Pfam:TRIC 36 227 4.1e-81 PFAM
low complexity region 249 256 N/A INTRINSIC
low complexity region 265 274 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144167
AA Change: C42R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120304
Gene: ENSMUSG00000028420
AA Change: C42R

DomainStartEndE-ValueType
Pfam:TRIC 9 164 3.1e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151206
Meta Mutation Damage Score 0.4782 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular monovalent cation channel that functions in maintenance of intracellular calcium release. Mutations in this gene may be associated with autosomal recessive osteogenesis. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous null newborn mice die of respiratory failure showing atelectasis, pulmonary congestion, impaired maturation of alveolar type II cells, reduced lamellar body formation, abnormal synthesis and secretion of surfactant phospholipids, and impaired Ca2+ release in alveolar type II cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
5730596B20Rik G T 6: 52,178,961 probably benign Het
9530053A07Rik T A 7: 28,156,648 D1953E probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Bnc2 A G 4: 84,293,514 V231A probably damaging Het
Bod1l A G 5: 41,821,455 S839P probably damaging Het
Casp8 T A 1: 58,833,698 H264Q possibly damaging Het
Cc2d1b A T 4: 108,625,352 probably benign Het
Cpne6 A T 14: 55,513,600 probably benign Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dgkd T A 1: 87,931,982 L774* probably null Het
Fbxl2 T A 9: 113,989,163 N205I probably benign Het
Fkbp15 A T 4: 62,336,456 I269K probably benign Het
Gm13023 G C 4: 143,794,774 C320S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Has1 G T 17: 17,850,036 R208S possibly damaging Het
Hecw1 C G 13: 14,317,139 A423P probably benign Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Ifi208 T G 1: 173,682,911 S211A probably benign Het
Ighv6-3 T C 12: 114,391,874 E65G probably damaging Het
Igkv9-120 A T 6: 68,050,333 D77V probably benign Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm2a A G 19: 4,322,521 I932T probably damaging Het
Krt17 T C 11: 100,257,868 T279A possibly damaging Het
Lamp1 T C 8: 13,167,192 V67A possibly damaging Het
Limk1 T C 5: 134,670,478 I142V probably benign Het
Mamdc2 T C 19: 23,374,017 N182D possibly damaging Het
Mcpt1 G A 14: 56,018,560 probably null Het
Med12l T G 3: 59,257,223 probably null Het
Mfsd10 G T 5: 34,635,625 T44N probably damaging Het
Mrps27 T C 13: 99,405,041 S218P probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Neil2 A C 14: 63,191,841 M1R probably null Het
Nelfcd T C 2: 174,427,048 F587L probably damaging Het
Nfil3 T C 13: 52,968,799 D23G probably benign Het
Nit2 T C 16: 57,157,160 K169R probably benign Het
Nxt1 T C 2: 148,675,347 S3P probably benign Het
Ogt A G X: 101,667,525 N434D probably damaging Het
Olfr679 T A 7: 105,085,787 S24T possibly damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rsl1 T C 13: 67,177,162 probably null Het
Sobp G A 10: 43,022,900 H230Y probably damaging Het
Sptan1 A G 2: 30,026,588 E2096G probably damaging Het
Tie1 G T 4: 118,478,405 S797* probably null Het
Tmem266 T C 9: 55,418,107 I186T probably damaging Het
Tnfaip6 T C 2: 52,050,864 F139S probably damaging Het
Tnrc6a T C 7: 123,171,680 S898P probably benign Het
Trim24 A G 6: 37,964,740 D911G probably damaging Het
Tyw5 T C 1: 57,388,488 probably benign Het
Ubr3 C T 2: 70,016,385 Q1651* probably null Het
Unc13c T A 9: 73,530,952 I1943F possibly damaging Het
Usp47 T A 7: 112,110,048 S1334T probably damaging Het
Vmn1r215 T A 13: 23,075,931 V47E probably benign Het
Vmn1r224 T A 17: 20,419,362 M67K possibly damaging Het
Wdfy3 T A 5: 101,922,634 probably null Het
Zfc3h1 T C 10: 115,418,799 Y1433H probably benign Het
Other mutations in Tmem38b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Tmem38b APN 4 53849024 missense probably damaging 1.00
IGL01948:Tmem38b APN 4 53850530 missense probably damaging 0.97
IGL02383:Tmem38b APN 4 53854345 missense probably benign
IGL02619:Tmem38b APN 4 53848871 missense probably damaging 1.00
R0266:Tmem38b UTSW 4 53840765 missense probably damaging 1.00
R0849:Tmem38b UTSW 4 53840765 missense probably damaging 1.00
R1658:Tmem38b UTSW 4 53840713 missense probably benign
R3845:Tmem38b UTSW 4 53859905 missense probably benign 0.10
R3930:Tmem38b UTSW 4 53854398 missense probably damaging 1.00
R4012:Tmem38b UTSW 4 53854409 missense probably benign 0.01
R4233:Tmem38b UTSW 4 53840710 missense probably damaging 1.00
R5388:Tmem38b UTSW 4 53859945 missense probably benign 0.04
R5708:Tmem38b UTSW 4 53849051 critical splice donor site probably null
R6083:Tmem38b UTSW 4 53840765 missense probably damaging 1.00
R8272:Tmem38b UTSW 4 53854332 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCCATGATGAGCACACTTG -3'
(R):5'- GGGTTCGTTCATTGCACATG -3'

Sequencing Primer
(F):5'- TTTCGGGAAATAAATCAACAAACGC -3'
(R):5'- GATCTCATAGTGCAGCCTA -3'
Posted On2015-06-12