Incidental Mutation 'R4235:Fkbp15'
ID321054
Institutional Source Beutler Lab
Gene Symbol Fkbp15
Ensembl Gene ENSMUSG00000066151
Gene NameFK506 binding protein 15
SynonymsFKBP133, C430014M02Rik
MMRRC Submission 041052-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4235 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location62300342-62360548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62336456 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 269 (I269K)
Ref Sequence ENSEMBL: ENSMUSP00000095641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084527] [ENSMUST00000084528] [ENSMUST00000098033] [ENSMUST00000107461]
Predicted Effect probably benign
Transcript: ENSMUST00000084527
AA Change: I269K

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000081575
Gene: ENSMUSG00000066151
AA Change: I269K

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 4.8e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 1.88e-10 PROSPERO
internal_repeat_1 472 500 1.88e-10 PROSPERO
coiled coil region 560 662 N/A INTRINSIC
coiled coil region 684 790 N/A INTRINSIC
coiled coil region 816 865 N/A INTRINSIC
coiled coil region 916 943 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
low complexity region 983 994 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084528
AA Change: I269K

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000081576
Gene: ENSMUSG00000066151
AA Change: I269K

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 2.4e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 2.74e-10 PROSPERO
internal_repeat_1 472 500 2.74e-10 PROSPERO
coiled coil region 560 662 N/A INTRINSIC
coiled coil region 684 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098033
AA Change: I269K

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095641
Gene: ENSMUSG00000066151
AA Change: I269K

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 1.9e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 1.79e-8 PROSPERO
internal_repeat_1 472 500 1.79e-8 PROSPERO
coiled coil region 560 608 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107461
AA Change: I269K

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103085
Gene: ENSMUSG00000066151
AA Change: I269K

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 2e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 1.86e-8 PROSPERO
internal_repeat_1 472 500 1.86e-8 PROSPERO
coiled coil region 560 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139308
Meta Mutation Damage Score 0.1403 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
5730596B20Rik G T 6: 52,178,961 probably benign Het
9530053A07Rik T A 7: 28,156,648 D1953E probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Bnc2 A G 4: 84,293,514 V231A probably damaging Het
Bod1l A G 5: 41,821,455 S839P probably damaging Het
Casp8 T A 1: 58,833,698 H264Q possibly damaging Het
Cc2d1b A T 4: 108,625,352 probably benign Het
Cpne6 A T 14: 55,513,600 probably benign Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dgkd T A 1: 87,931,982 L774* probably null Het
Fbxl2 T A 9: 113,989,163 N205I probably benign Het
Gm13023 G C 4: 143,794,774 C320S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Has1 G T 17: 17,850,036 R208S possibly damaging Het
Hecw1 C G 13: 14,317,139 A423P probably benign Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Ifi208 T G 1: 173,682,911 S211A probably benign Het
Ighv6-3 T C 12: 114,391,874 E65G probably damaging Het
Igkv9-120 A T 6: 68,050,333 D77V probably benign Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm2a A G 19: 4,322,521 I932T probably damaging Het
Krt17 T C 11: 100,257,868 T279A possibly damaging Het
Lamp1 T C 8: 13,167,192 V67A possibly damaging Het
Limk1 T C 5: 134,670,478 I142V probably benign Het
Mamdc2 T C 19: 23,374,017 N182D possibly damaging Het
Mcpt1 G A 14: 56,018,560 probably null Het
Med12l T G 3: 59,257,223 probably null Het
Mfsd10 G T 5: 34,635,625 T44N probably damaging Het
Mrps27 T C 13: 99,405,041 S218P probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Neil2 A C 14: 63,191,841 M1R probably null Het
Nelfcd T C 2: 174,427,048 F587L probably damaging Het
Nfil3 T C 13: 52,968,799 D23G probably benign Het
Nit2 T C 16: 57,157,160 K169R probably benign Het
Nxt1 T C 2: 148,675,347 S3P probably benign Het
Ogt A G X: 101,667,525 N434D probably damaging Het
Olfr679 T A 7: 105,085,787 S24T possibly damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rsl1 T C 13: 67,177,162 probably null Het
Sobp G A 10: 43,022,900 H230Y probably damaging Het
Sptan1 A G 2: 30,026,588 E2096G probably damaging Het
Tie1 G T 4: 118,478,405 S797* probably null Het
Tmem266 T C 9: 55,418,107 I186T probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tnfaip6 T C 2: 52,050,864 F139S probably damaging Het
Tnrc6a T C 7: 123,171,680 S898P probably benign Het
Trim24 A G 6: 37,964,740 D911G probably damaging Het
Tyw5 T C 1: 57,388,488 probably benign Het
Ubr3 C T 2: 70,016,385 Q1651* probably null Het
Unc13c T A 9: 73,530,952 I1943F possibly damaging Het
Usp47 T A 7: 112,110,048 S1334T probably damaging Het
Vmn1r215 T A 13: 23,075,931 V47E probably benign Het
Vmn1r224 T A 17: 20,419,362 M67K possibly damaging Het
Wdfy3 T A 5: 101,922,634 probably null Het
Zfc3h1 T C 10: 115,418,799 Y1433H probably benign Het
Other mutations in Fkbp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Fkbp15 APN 4 62333680 splice site probably benign
IGL01326:Fkbp15 APN 4 62323250 missense probably damaging 0.98
IGL01822:Fkbp15 APN 4 62352504 missense probably benign
IGL01925:Fkbp15 APN 4 62323213 missense probably damaging 1.00
IGL02190:Fkbp15 APN 4 62304822 missense possibly damaging 0.69
IGL02276:Fkbp15 APN 4 62336466 nonsense probably null
IGL02310:Fkbp15 APN 4 62340316 missense probably damaging 1.00
IGL02954:Fkbp15 APN 4 62321065 splice site probably benign
IGL02967:Fkbp15 APN 4 62304390 missense probably damaging 0.96
IGL03136:Fkbp15 APN 4 62340229 splice site probably benign
IGL03185:Fkbp15 APN 4 62332186 splice site probably null
IGL03280:Fkbp15 APN 4 62303267 unclassified probably benign
dura UTSW 4 62324126 missense probably damaging 0.96
mater UTSW 4 62326136 missense probably benign 0.22
R0419:Fkbp15 UTSW 4 62326136 missense probably benign 0.22
R0838:Fkbp15 UTSW 4 62324126 missense probably damaging 0.96
R1241:Fkbp15 UTSW 4 62304609 missense possibly damaging 0.87
R1394:Fkbp15 UTSW 4 62327872 missense probably benign 0.00
R1622:Fkbp15 UTSW 4 62323202 missense possibly damaging 0.94
R1682:Fkbp15 UTSW 4 62324194 missense probably damaging 0.98
R1823:Fkbp15 UTSW 4 62337091 missense probably damaging 1.00
R1994:Fkbp15 UTSW 4 62304381 missense probably benign 0.00
R2132:Fkbp15 UTSW 4 62327899 missense probably damaging 1.00
R2133:Fkbp15 UTSW 4 62327899 missense probably damaging 1.00
R2425:Fkbp15 UTSW 4 62312365 missense probably benign 0.00
R2938:Fkbp15 UTSW 4 62304663 missense probably benign 0.23
R3034:Fkbp15 UTSW 4 62306892 splice site probably null
R3957:Fkbp15 UTSW 4 62334252 missense probably benign 0.01
R3963:Fkbp15 UTSW 4 62340677 missense probably damaging 1.00
R4334:Fkbp15 UTSW 4 62303219 missense possibly damaging 0.95
R4366:Fkbp15 UTSW 4 62336414 missense probably benign 0.38
R4717:Fkbp15 UTSW 4 62308069 missense probably damaging 1.00
R4790:Fkbp15 UTSW 4 62307997 missense probably benign 0.05
R5075:Fkbp15 UTSW 4 62321029 missense probably damaging 0.96
R5176:Fkbp15 UTSW 4 62312323 missense possibly damaging 0.68
R5419:Fkbp15 UTSW 4 62327877 missense probably damaging 0.98
R5503:Fkbp15 UTSW 4 62327887 missense probably benign 0.05
R5731:Fkbp15 UTSW 4 62306929 missense probably benign 0.01
R5733:Fkbp15 UTSW 4 62306929 missense probably benign 0.01
R5820:Fkbp15 UTSW 4 62345546 missense probably benign 0.00
R5878:Fkbp15 UTSW 4 62306908 missense probably benign
R5898:Fkbp15 UTSW 4 62326057 critical splice donor site probably null
R5914:Fkbp15 UTSW 4 62327810 splice site probably null
R6113:Fkbp15 UTSW 4 62340647 missense probably benign 0.38
R6377:Fkbp15 UTSW 4 62324192 missense probably damaging 1.00
R6427:Fkbp15 UTSW 4 62323202 missense probably benign 0.01
R6464:Fkbp15 UTSW 4 62308078 missense possibly damaging 0.92
R6528:Fkbp15 UTSW 4 62332270 missense probably damaging 1.00
R6790:Fkbp15 UTSW 4 62304759 missense probably benign 0.01
R6880:Fkbp15 UTSW 4 62336495 missense possibly damaging 0.71
R6911:Fkbp15 UTSW 4 62340290 missense probably damaging 1.00
R7371:Fkbp15 UTSW 4 62321056 missense possibly damaging 0.89
R7410:Fkbp15 UTSW 4 62340299 missense probably damaging 1.00
R7660:Fkbp15 UTSW 4 62314341 missense probably benign 0.08
R7992:Fkbp15 UTSW 4 62312301 missense probably damaging 1.00
X0013:Fkbp15 UTSW 4 62312370 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GCTTAACTCCAATGCCATTTTCAG -3'
(R):5'- GCTGTTTGACTCAAATTCTTTGGAG -3'

Sequencing Primer
(F):5'- GTGTGGTCAATACAAATCTGCACC -3'
(R):5'- TCTTTGGAGAATTCTTTGTTCACG -3'
Posted On2015-06-12