Incidental Mutation 'R4235:Mfsd10'
ID321059
Institutional Source Beutler Lab
Gene Symbol Mfsd10
Ensembl Gene ENSMUSG00000001082
Gene Namemajor facilitator superfamily domain containing 10
SynonymsTetran, 0610009O03Rik
MMRRC Submission 041052-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4235 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location34633642-34637212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34635625 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 44 (T44N)
Ref Sequence ENSEMBL: ENSMUSP00000144239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001108] [ENSMUST00000001109] [ENSMUST00000041364] [ENSMUST00000052836] [ENSMUST00000114329] [ENSMUST00000114331] [ENSMUST00000114335] [ENSMUST00000114338] [ENSMUST00000114340] [ENSMUST00000124668] [ENSMUST00000126257] [ENSMUST00000134156] [ENSMUST00000155577] [ENSMUST00000149657] [ENSMUST00000201147] [ENSMUST00000201810] [ENSMUST00000202378] [ENSMUST00000137150] [ENSMUST00000137506]
Predicted Effect probably benign
Transcript: ENSMUST00000001108
SMART Domains Protein: ENSMUSP00000001108
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000001109
AA Change: T173N

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000001109
Gene: ENSMUSG00000001082
AA Change: T173N

DomainStartEndE-ValueType
Pfam:MFS_1 29 413 6.9e-41 PFAM
Pfam:Sugar_tr 62 235 7.9e-9 PFAM
transmembrane domain 422 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041364
SMART Domains Protein: ENSMUSP00000038382
Gene: ENSMUSG00000036693

DomainStartEndE-ValueType
Pfam:Nop14 21 849 2.2e-273 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052836
SMART Domains Protein: ENSMUSP00000052266
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114329
AA Change: T173N

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000109968
Gene: ENSMUSG00000001082
AA Change: T173N

DomainStartEndE-ValueType
Pfam:MFS_1 29 413 6.8e-41 PFAM
Pfam:Sugar_tr 71 228 2.3e-9 PFAM
transmembrane domain 422 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114331
AA Change: T173N

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000109970
Gene: ENSMUSG00000001082
AA Change: T173N

DomainStartEndE-ValueType
Pfam:MFS_1 29 413 6.8e-41 PFAM
Pfam:Sugar_tr 71 228 2.3e-9 PFAM
transmembrane domain 422 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114335
SMART Domains Protein: ENSMUSP00000109974
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 597 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114338
SMART Domains Protein: ENSMUSP00000109977
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114340
SMART Domains Protein: ENSMUSP00000109979
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
low complexity region 666 685 N/A INTRINSIC
low complexity region 698 719 N/A INTRINSIC
low complexity region 727 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124668
SMART Domains Protein: ENSMUSP00000119140
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126257
SMART Domains Protein: ENSMUSP00000144630
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
Pfam:MFS_1 29 139 5.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130347
Predicted Effect probably benign
Transcript: ENSMUST00000134156
SMART Domains Protein: ENSMUSP00000143812
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148270
Predicted Effect probably benign
Transcript: ENSMUST00000155577
AA Change: T173N

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000115204
Gene: ENSMUSG00000001082
AA Change: T173N

DomainStartEndE-ValueType
Pfam:MFS_1 29 269 1.1e-27 PFAM
Pfam:Sugar_tr 71 228 9.6e-10 PFAM
Pfam:TRI12 76 232 3.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149657
AA Change: T173N

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000118786
Gene: ENSMUSG00000001082
AA Change: T173N

DomainStartEndE-ValueType
Pfam:MFS_1 29 261 1.3e-26 PFAM
Pfam:Sugar_tr 71 228 9.3e-10 PFAM
Pfam:TRI12 76 232 3.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151247
Predicted Effect probably damaging
Transcript: ENSMUST00000201147
AA Change: T44N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144239
Gene: ENSMUSG00000001082
AA Change: T44N

DomainStartEndE-ValueType
low complexity region 80 95 N/A INTRINSIC
low complexity region 104 130 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137744
Predicted Effect probably benign
Transcript: ENSMUST00000202065
Predicted Effect probably benign
Transcript: ENSMUST00000201810
SMART Domains Protein: ENSMUSP00000144673
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
coiled coil region 142 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152805
SMART Domains Protein: ENSMUSP00000121402
Gene: ENSMUSG00000029106

DomainStartEndE-ValueType
coiled coil region 95 127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202378
SMART Domains Protein: ENSMUSP00000144117
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
transmembrane domain 24 43 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137150
SMART Domains Protein: ENSMUSP00000120814
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137506
SMART Domains Protein: ENSMUSP00000144121
Gene: ENSMUSG00000001082

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 31 50 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the major facilitator superfamily of transporter proteins. The encoded protein likely functions in efflux of organic anions, including the non-steroidal anti-inflammatory drugs indomethacin and diclofenac. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
5730596B20Rik G T 6: 52,178,961 probably benign Het
9530053A07Rik T A 7: 28,156,648 D1953E probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Bnc2 A G 4: 84,293,514 V231A probably damaging Het
Bod1l A G 5: 41,821,455 S839P probably damaging Het
Casp8 T A 1: 58,833,698 H264Q possibly damaging Het
Cc2d1b A T 4: 108,625,352 probably benign Het
Cpne6 A T 14: 55,513,600 probably benign Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dgkd T A 1: 87,931,982 L774* probably null Het
Fbxl2 T A 9: 113,989,163 N205I probably benign Het
Fkbp15 A T 4: 62,336,456 I269K probably benign Het
Gm13023 G C 4: 143,794,774 C320S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Has1 G T 17: 17,850,036 R208S possibly damaging Het
Hecw1 C G 13: 14,317,139 A423P probably benign Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Ifi208 T G 1: 173,682,911 S211A probably benign Het
Ighv6-3 T C 12: 114,391,874 E65G probably damaging Het
Igkv9-120 A T 6: 68,050,333 D77V probably benign Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm2a A G 19: 4,322,521 I932T probably damaging Het
Krt17 T C 11: 100,257,868 T279A possibly damaging Het
Lamp1 T C 8: 13,167,192 V67A possibly damaging Het
Limk1 T C 5: 134,670,478 I142V probably benign Het
Mamdc2 T C 19: 23,374,017 N182D possibly damaging Het
Mcpt1 G A 14: 56,018,560 probably null Het
Med12l T G 3: 59,257,223 probably null Het
Mrps27 T C 13: 99,405,041 S218P probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Neil2 A C 14: 63,191,841 M1R probably null Het
Nelfcd T C 2: 174,427,048 F587L probably damaging Het
Nfil3 T C 13: 52,968,799 D23G probably benign Het
Nit2 T C 16: 57,157,160 K169R probably benign Het
Nxt1 T C 2: 148,675,347 S3P probably benign Het
Ogt A G X: 101,667,525 N434D probably damaging Het
Olfr679 T A 7: 105,085,787 S24T possibly damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rsl1 T C 13: 67,177,162 probably null Het
Sobp G A 10: 43,022,900 H230Y probably damaging Het
Sptan1 A G 2: 30,026,588 E2096G probably damaging Het
Tie1 G T 4: 118,478,405 S797* probably null Het
Tmem266 T C 9: 55,418,107 I186T probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tnfaip6 T C 2: 52,050,864 F139S probably damaging Het
Tnrc6a T C 7: 123,171,680 S898P probably benign Het
Trim24 A G 6: 37,964,740 D911G probably damaging Het
Tyw5 T C 1: 57,388,488 probably benign Het
Ubr3 C T 2: 70,016,385 Q1651* probably null Het
Unc13c T A 9: 73,530,952 I1943F possibly damaging Het
Usp47 T A 7: 112,110,048 S1334T probably damaging Het
Vmn1r215 T A 13: 23,075,931 V47E probably benign Het
Vmn1r224 T A 17: 20,419,362 M67K possibly damaging Het
Wdfy3 T A 5: 101,922,634 probably null Het
Zfc3h1 T C 10: 115,418,799 Y1433H probably benign Het
Other mutations in Mfsd10
AlleleSourceChrCoordTypePredicted EffectPPH Score
E0374:Mfsd10 UTSW 5 34636637 splice site probably null
R0226:Mfsd10 UTSW 5 34634446 missense probably benign 0.03
R0265:Mfsd10 UTSW 5 34635163 splice site probably benign
R1803:Mfsd10 UTSW 5 34636750 missense possibly damaging 0.81
R4782:Mfsd10 UTSW 5 34634949 intron probably benign
R5861:Mfsd10 UTSW 5 34634244 unclassified probably benign
R6781:Mfsd10 UTSW 5 34634509 missense possibly damaging 0.71
R7381:Mfsd10 UTSW 5 34636426 missense probably damaging 1.00
R7846:Mfsd10 UTSW 5 34636112 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCACCATTTCCACAGACAG -3'
(R):5'- AGGGTTATATGCTTGCCTGC -3'

Sequencing Primer
(F):5'- TTTCCACAGACAGGAATGCTC -3'
(R):5'- AAGTGACCGATCCTGCCACTTG -3'
Posted On2015-06-12