Incidental Mutation 'R0398:Ogfr'
ID32106
Institutional Source Beutler Lab
Gene Symbol Ogfr
Ensembl Gene ENSMUSG00000049401
Gene Nameopioid growth factor receptor
Synonyms2010013E17Rik
MMRRC Submission 038603-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.476) question?
Stock #R0398 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location180589245-180595836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 180593699 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 189 (R189G)
Ref Sequence ENSEMBL: ENSMUSP00000029087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029087] [ENSMUST00000103059] [ENSMUST00000132527]
Predicted Effect probably damaging
Transcript: ENSMUST00000029087
AA Change: R189G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029087
Gene: ENSMUSG00000049401
AA Change: R189G

DomainStartEndE-ValueType
low complexity region 7 40 N/A INTRINSIC
Pfam:OGFr_N 76 283 2.3e-111 PFAM
low complexity region 358 369 N/A INTRINSIC
internal_repeat_1 459 483 4.08e-5 PROSPERO
internal_repeat_1 576 600 4.08e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103059
SMART Domains Protein: ENSMUSP00000099348
Gene: ENSMUSG00000027570

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.7e-12 PFAM
Pfam:Collagen 58 114 4.2e-9 PFAM
low complexity region 126 162 N/A INTRINSIC
Pfam:Collagen 174 236 4.1e-12 PFAM
Pfam:Collagen 213 292 8e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.8e-11 PFAM
low complexity region 635 656 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132527
SMART Domains Protein: ENSMUSP00000128718
Gene: ENSMUSG00000027570

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.9e-12 PFAM
Pfam:Collagen 58 114 4.3e-9 PFAM
Pfam:Collagen 109 166 4.5e-8 PFAM
Pfam:Collagen 174 236 4.2e-12 PFAM
Pfam:Collagen 213 292 8.2e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 402 474 8.2e-8 PFAM
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.9e-11 PFAM
Pfam:Collagen 603 662 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147070
Meta Mutation Damage Score 0.8650 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.8%
  • 20x: 83.2%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for opioid growth factor (OGF), also known as [Met(5)]-enkephalin. OGF is a negative regulator of cell proliferation and tissue organization in a variety of processes. The encoded unbound receptor for OGF has been localized to the outer nuclear envelope, where it binds OGF and is translocated into the nucleus. The coding sequence of this gene contains a polymorphic region of 60 nt tandem imperfect repeat units. Several transcripts containing between zero and eight repeat units have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A G 5: 9,445,367 R724G probably benign Het
Abcb11 T C 2: 69,286,666 Q546R probably null Het
Acr T G 15: 89,573,941 V275G probably damaging Het
Adam5 A G 8: 24,813,432 Y160H probably benign Het
Adcy5 T A 16: 35,269,068 M545K probably damaging Het
Aoc2 A G 11: 101,325,553 E154G possibly damaging Het
Atg2a T G 19: 6,246,578 L338R probably damaging Het
Atp2a1 T C 7: 126,450,418 probably benign Het
Bbs7 A G 3: 36,590,717 S436P probably benign Het
Bpnt1 T C 1: 185,338,158 Y16H probably benign Het
Cbll1 A T 12: 31,492,092 F90Y probably damaging Het
Cbs G T 17: 31,617,242 Q411K probably benign Het
Cdca2 A C 14: 67,697,962 F435V probably damaging Het
Cdh13 T G 8: 119,314,047 S664A probably damaging Het
Cdk17 T A 10: 93,237,840 V438E probably benign Het
Cep295 T C 9: 15,354,736 D40G possibly damaging Het
Col6a1 T C 10: 76,710,118 H840R unknown Het
Cpa1 A G 6: 30,645,251 T409A probably benign Het
Crlf1 G A 8: 70,499,089 probably benign Het
E2f2 T A 4: 136,180,544 I184N probably damaging Het
Ehbp1 T C 11: 22,095,886 D596G probably damaging Het
Ets2 A G 16: 95,716,223 Y333C probably damaging Het
Fam178b A G 1: 36,632,406 probably benign Het
Fndc3b A G 3: 27,461,779 V626A probably benign Het
Gart G T 16: 91,639,449 A140E probably damaging Het
Gbp7 T C 3: 142,545,513 S477P possibly damaging Het
Gm16380 T C 9: 53,884,169 noncoding transcript Het
Hmcn1 C A 1: 150,798,814 R579M possibly damaging Het
Hoxb8 A C 11: 96,283,111 H50P probably damaging Het
Hspa4 C T 11: 53,272,879 probably null Het
Hspa4l G A 3: 40,756,997 probably benign Het
Hyal4 A T 6: 24,756,671 Y296F probably damaging Het
Igsf8 C A 1: 172,317,499 T131K probably damaging Het
Ilvbl C T 10: 78,579,539 P298L probably damaging Het
Jak2 T A 19: 29,282,388 I229N possibly damaging Het
Kif1b T C 4: 149,204,231 D1205G possibly damaging Het
Lrrc63 T C 14: 75,126,470 R74G probably benign Het
Lvrn A G 18: 46,880,693 T481A probably benign Het
Macf1 T A 4: 123,351,017 T7312S probably damaging Het
Magel2 C T 7: 62,380,551 Q1068* probably null Het
Mrpl3 A G 9: 105,064,103 Y203C probably damaging Het
Nek2 T A 1: 191,827,361 I326N probably benign Het
Nlrc4 A C 17: 74,445,920 N489K probably damaging Het
Nlrp4f A T 13: 65,194,918 S304R possibly damaging Het
Olfr1151 A T 2: 87,858,057 N294I probably damaging Het
Olfr506 T A 7: 108,612,955 I216N probably benign Het
Olfr548-ps1 T A 7: 102,542,692 L252H probably damaging Het
Orm3 A G 4: 63,357,648 S145G probably benign Het
Pclo A G 5: 14,681,702 E3406G unknown Het
Pcx T G 19: 4,601,610 F4C probably benign Het
Pgd C A 4: 149,153,882 G364V probably damaging Het
Pla2g12a C A 3: 129,890,396 D102E probably benign Het
Pnpo A T 11: 96,942,427 C82* probably null Het
Prdm1 T C 10: 44,439,809 N792S probably damaging Het
Prim2 A T 1: 33,484,676 probably benign Het
Proca1 C A 11: 78,205,268 P242Q probably benign Het
Psmc5 A G 11: 106,261,544 N129S probably benign Het
Ptchd4 A G 17: 42,377,259 T231A possibly damaging Het
Qrfpr C T 3: 36,181,052 probably benign Het
Rab44 G A 17: 29,145,370 probably benign Het
Racgap1 T C 15: 99,628,627 probably benign Het
Rapgef4 A G 2: 72,031,041 E25G probably damaging Het
Rpl8 G C 15: 76,905,046 probably benign Het
Samd12 G A 15: 53,719,720 P73S possibly damaging Het
Samd9l T A 6: 3,374,502 N920Y probably damaging Het
Sdk1 T C 5: 141,962,721 V607A probably benign Het
Slc25a19 A G 11: 115,617,575 Y196H probably damaging Het
Slc39a3 A T 10: 81,033,787 M12K possibly damaging Het
Slc5a4a T C 10: 76,182,722 I501T possibly damaging Het
Sp4 A T 12: 118,298,673 V546D possibly damaging Het
Ssh3 C T 19: 4,263,699 V511M possibly damaging Het
Stard9 T G 2: 120,696,307 V1015G probably benign Het
Thoc5 G T 11: 4,921,978 V516F possibly damaging Het
Ttc21a T A 9: 119,954,562 I570N probably damaging Het
Ttc4 T C 4: 106,667,573 probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Yipf3 A G 17: 46,251,485 E298G possibly damaging Het
Zbtb34 C A 2: 33,411,048 E494* probably null Het
Zfhx3 A G 8: 108,951,246 Y2976C probably damaging Het
Other mutations in Ogfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Ogfr APN 2 180593562 unclassified probably benign
IGL02437:Ogfr APN 2 180589536 missense possibly damaging 0.72
IGL02602:Ogfr APN 2 180595437 missense possibly damaging 0.85
IGL02609:Ogfr APN 2 180592515 splice site probably benign
IGL03297:Ogfr APN 2 180594407 missense possibly damaging 0.93
BB017:Ogfr UTSW 2 180595266 unclassified probably benign
PIT4812001:Ogfr UTSW 2 180595511 missense possibly damaging 0.93
R0085:Ogfr UTSW 2 180591037 splice site probably null
R1313:Ogfr UTSW 2 180594630 missense probably benign
R1313:Ogfr UTSW 2 180594630 missense probably benign
R1468:Ogfr UTSW 2 180594750 missense probably damaging 1.00
R1468:Ogfr UTSW 2 180594750 missense probably damaging 1.00
R4747:Ogfr UTSW 2 180594423 missense probably damaging 0.99
R4902:Ogfr UTSW 2 180593725 unclassified probably benign
R5422:Ogfr UTSW 2 180595274 missense possibly damaging 0.63
R5422:Ogfr UTSW 2 180595275 missense probably benign 0.02
R5860:Ogfr UTSW 2 180592492 missense probably damaging 1.00
R5988:Ogfr UTSW 2 180594233 missense probably damaging 1.00
R6015:Ogfr UTSW 2 180594674 missense probably damaging 1.00
R6558:Ogfr UTSW 2 180595404 missense possibly damaging 0.93
R6721:Ogfr UTSW 2 180595428 missense possibly damaging 0.70
R7111:Ogfr UTSW 2 180595266 unclassified probably benign
R7201:Ogfr UTSW 2 180595094 unclassified probably benign
R7217:Ogfr UTSW 2 180595266 unclassified probably benign
R7243:Ogfr UTSW 2 180595266 unclassified probably benign
R7387:Ogfr UTSW 2 180595266 unclassified probably benign
R7563:Ogfr UTSW 2 180592507 critical splice donor site probably null
R7681:Ogfr UTSW 2 180595266 unclassified probably benign
R7844:Ogfr UTSW 2 180595057 unclassified probably benign
R7845:Ogfr UTSW 2 180595266 unclassified probably benign
R7848:Ogfr UTSW 2 180592433 missense probably damaging 1.00
R7930:Ogfr UTSW 2 180595266 unclassified probably benign
R7985:Ogfr UTSW 2 180595057 unclassified probably benign
R8011:Ogfr UTSW 2 180595266 unclassified probably benign
R8039:Ogfr UTSW 2 180595266 unclassified probably benign
R8045:Ogfr UTSW 2 180595057 unclassified probably benign
R8094:Ogfr UTSW 2 180595266 unclassified probably benign
R8339:Ogfr UTSW 2 180595266 unclassified probably benign
RF022:Ogfr UTSW 2 180595266 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCAGGCTGAATCAGGGTCTAAGGG -3'
(R):5'- AGCCAAGGAACTGCTTTGTCCATC -3'

Sequencing Primer
(F):5'- GGGTCTAAGGGAAAAATCACCCTAC -3'
(R):5'- AATTTCTACAACACCTCTATCCTGAG -3'
Posted On2013-04-24