Mutagenetix > Incidental Mutation

Incidental Mutation 'R4235:Tnrc6a'

321068

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6a

Ensembl Gene

ENSMUSG00000052707

Gene Name

trinucleotide repeat containing 6a

Synonyms

CAGH26, 2010321I05Rik, Tnrc6, 3110054G10Rik, D130023A07Rik

MMRRC Submission

041052-MU

Accession Numbers

Genbank: NM_144925; MGI: 2385292

Essential gene?

Probably essential (E-score: 0.850) question?

Stock #

R4235 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123123885-123195296 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123171680 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 898 (S898P)

Ref Sequence

ENSEMBL: ENSMUSP00000091595 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094053] [ENSMUST00000205514] [ENSMUST00000206014] [ENSMUST00000206888]

AlphaFold

Q3UHK8

Predicted Effect

probably benign
Transcript: ENSMUST00000094053
AA Change: S898P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000091595
Gene: ENSMUSG00000052707
AA Change: S898P

Domain	Start	End	E-Value	Type
coiled coil region	5	54	N/A	INTRINSIC
low complexity region	69	92	N/A	INTRINSIC
low complexity region	93	113	N/A	INTRINSIC
low complexity region	281	294	N/A	INTRINSIC
low complexity region	430	443	N/A	INTRINSIC
low complexity region	568	590	N/A	INTRINSIC
internal_repeat_1	690	853	3.51e-6	PROSPERO
low complexity region	858	871	N/A	INTRINSIC
Pfam:Ago_hook	1028	1190	1.2e-29	PFAM
low complexity region	1284	1296	N/A	INTRINSIC
low complexity region	1301	1316	N/A	INTRINSIC
low complexity region	1337	1376	N/A	INTRINSIC
low complexity region	1386	1392	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1439	1714	1.5e-126	PFAM
RRM	1717	1784	4.95e-2	SMART
low complexity region	1808	1820	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205449

Predicted Effect

probably benign
Transcript: ENSMUST00000205514

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205732

Predicted Effect

unknown
Transcript: ENSMUST00000205760
AA Change: S350P

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205789

Predicted Effect

probably benign
Transcript: ENSMUST00000206014

Predicted Effect

probably benign
Transcript: ENSMUST00000206888

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206922

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211170

Meta Mutation Damage Score

0.0582

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein is highly similar to a human protein that functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The human protein associates with messenger RNAs and argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies, and inhibiting its expression delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial embryonic lethality during organogenesis associated with impaired hematopoiesis. [provided by MGI curators]

Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
5730596B20Rik	G	T	6: 52,178,961		probably benign	Het
9530053A07Rik	T	A	7: 28,156,648	D1953E	probably damaging	Het
Akap6	T	A	12: 53,139,671	N1289K	probably damaging	Het
Arhgap21	A	G	2: 20,887,137	V161A	probably damaging	Het
Arhgef18	T	C	8: 3,450,317	I541T	possibly damaging	Het
Atp7b	A	G	8: 22,011,023	Y955H	possibly damaging	Het
Bnc2	A	G	4: 84,293,514	V231A	probably damaging	Het
Bod1l	A	G	5: 41,821,455	S839P	probably damaging	Het
Casp8	T	A	1: 58,833,698	H264Q	possibly damaging	Het
Cc2d1b	A	T	4: 108,625,352		probably benign	Het
Cpne6	A	T	14: 55,513,600		probably benign	Het
Ddx1	C	T	12: 13,223,857	V590I	possibly damaging	Het
Dgkd	T	A	1: 87,931,982	L774*	probably null	Het
Fbxl2	T	A	9: 113,989,163	N205I	probably benign	Het
Fkbp15	A	T	4: 62,336,456	I269K	probably benign	Het
Gm13023	G	C	4: 143,794,774	C320S	probably damaging	Het
Gm26678	T	C	3: 54,633,083		noncoding transcript	Het
Has1	G	T	17: 17,850,036	R208S	possibly damaging	Het
Hecw1	C	G	13: 14,317,139	A423P	probably benign	Het
Hspa12b	T	C	2: 131,139,012	V162A	probably benign	Het
Ifi208	T	G	1: 173,682,911	S211A	probably benign	Het
Ighv6-3	T	C	12: 114,391,874	E65G	probably damaging	Het
Igkv9-120	A	T	6: 68,050,333	D77V	probably benign	Het
Impg1	A	G	9: 80,345,329	L523P	probably damaging	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Kdm2a	A	G	19: 4,322,521	I932T	probably damaging	Het
Krt17	T	C	11: 100,257,868	T279A	possibly damaging	Het
Lamp1	T	C	8: 13,167,192	V67A	possibly damaging	Het
Limk1	T	C	5: 134,670,478	I142V	probably benign	Het
Mamdc2	T	C	19: 23,374,017	N182D	possibly damaging	Het
Mcpt1	G	A	14: 56,018,560		probably null	Het
Med12l	T	G	3: 59,257,223		probably null	Het
Mfsd10	G	T	5: 34,635,625	T44N	probably damaging	Het
Mrps27	T	C	13: 99,405,041	S218P	probably damaging	Het
Mrps30	T	C	13: 118,386,840	D132G	probably damaging	Het
Neil2	A	C	14: 63,191,841	M1R	probably null	Het
Nelfcd	T	C	2: 174,427,048	F587L	probably damaging	Het
Nfil3	T	C	13: 52,968,799	D23G	probably benign	Het
Nit2	T	C	16: 57,157,160	K169R	probably benign	Het
Nxt1	T	C	2: 148,675,347	S3P	probably benign	Het
Ogt	A	G	X: 101,667,525	N434D	probably damaging	Het
Olfr679	T	A	7: 105,085,787	S24T	possibly damaging	Het
Pcdhga5	A	G	18: 37,695,948	D483G	possibly damaging	Het
Ralgapa1	C	T	12: 55,640,644	R2019Q	probably damaging	Het
Rsl1	T	C	13: 67,177,162		probably null	Het
Sobp	G	A	10: 43,022,900	H230Y	probably damaging	Het
Sptan1	A	G	2: 30,026,588	E2096G	probably damaging	Het
Tie1	G	T	4: 118,478,405	S797*	probably null	Het
Tmem266	T	C	9: 55,418,107	I186T	probably damaging	Het
Tmem38b	T	C	4: 53,840,710	C66R	probably damaging	Het
Tnfaip6	T	C	2: 52,050,864	F139S	probably damaging	Het
Trim24	A	G	6: 37,964,740	D911G	probably damaging	Het
Tyw5	T	C	1: 57,388,488		probably benign	Het
Ubr3	C	T	2: 70,016,385	Q1651*	probably null	Het
Unc13c	T	A	9: 73,530,952	I1943F	possibly damaging	Het
Usp47	T	A	7: 112,110,048	S1334T	probably damaging	Het
Vmn1r215	T	A	13: 23,075,931	V47E	probably benign	Het
Vmn1r224	T	A	17: 20,419,362	M67K	possibly damaging	Het
Wdfy3	T	A	5: 101,922,634		probably null	Het
Zfc3h1	T	C	10: 115,418,799	Y1433H	probably benign	Het

Other mutations in Tnrc6a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Tnrc6a	APN	7	123170780	missense	probably benign	0.04
IGL00580:Tnrc6a	APN	7	123174278	missense	probably damaging	1.00
IGL01309:Tnrc6a	APN	7	123171494	missense	probably benign	0.04
IGL02004:Tnrc6a	APN	7	123181366	missense	possibly damaging	0.57
IGL02142:Tnrc6a	APN	7	123152191	intron	probably benign
IGL02220:Tnrc6a	APN	7	123170456	missense	probably benign
IGL02436:Tnrc6a	APN	7	123184215	nonsense	probably null
IGL02670:Tnrc6a	APN	7	123171312	missense	possibly damaging	0.92
IGL02743:Tnrc6a	APN	7	123171473	missense	probably damaging	1.00
0152:Tnrc6a	UTSW	7	123180654	missense	probably damaging	1.00
R0008:Tnrc6a	UTSW	7	123170394	missense	probably benign	0.00
R0008:Tnrc6a	UTSW	7	123170394	missense	probably benign	0.00
R0369:Tnrc6a	UTSW	7	123170860	missense	probably damaging	1.00
R0512:Tnrc6a	UTSW	7	123186728	splice site	probably benign
R0566:Tnrc6a	UTSW	7	123170913	missense	probably benign	0.00
R0600:Tnrc6a	UTSW	7	123171816	missense	probably benign	0.14
R0751:Tnrc6a	UTSW	7	123170340	missense	possibly damaging	0.73
R1184:Tnrc6a	UTSW	7	123170340	missense	possibly damaging	0.73
R1319:Tnrc6a	UTSW	7	123184251	missense	probably benign	0.02
R1405:Tnrc6a	UTSW	7	123171078	missense	probably damaging	1.00
R1405:Tnrc6a	UTSW	7	123171078	missense	probably damaging	1.00
R1585:Tnrc6a	UTSW	7	123176875	missense	probably benign	0.08
R1709:Tnrc6a	UTSW	7	123169982	missense	probably benign	0.10
R1776:Tnrc6a	UTSW	7	123171297	missense	probably damaging	1.00
R1791:Tnrc6a	UTSW	7	123192917	missense	possibly damaging	0.47
R1807:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R1876:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R2010:Tnrc6a	UTSW	7	123171046	missense	probably benign	0.26
R2086:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R2089:Tnrc6a	UTSW	7	123172120	critical splice donor site	probably null
R2091:Tnrc6a	UTSW	7	123172120	critical splice donor site	probably null
R2091:Tnrc6a	UTSW	7	123172120	critical splice donor site	probably null
R2511:Tnrc6a	UTSW	7	123171092	missense	probably damaging	1.00
R2830:Tnrc6a	UTSW	7	123192949	makesense	probably null
R2850:Tnrc6a	UTSW	7	123179800	missense	probably damaging	1.00
R3916:Tnrc6a	UTSW	7	123181384	missense	probably damaging	1.00
R4028:Tnrc6a	UTSW	7	123170121	missense	probably damaging	1.00
R4439:Tnrc6a	UTSW	7	123152182	nonsense	probably null
R4525:Tnrc6a	UTSW	7	123179782	missense	probably benign
R4578:Tnrc6a	UTSW	7	123184221	missense	possibly damaging	0.89
R4613:Tnrc6a	UTSW	7	123184289	critical splice donor site	probably null
R4711:Tnrc6a	UTSW	7	123171078	missense	probably damaging	1.00
R4722:Tnrc6a	UTSW	7	123192090	missense	possibly damaging	0.78
R4746:Tnrc6a	UTSW	7	123189997	missense	probably damaging	1.00
R4892:Tnrc6a	UTSW	7	123169911	missense	probably damaging	1.00
R4942:Tnrc6a	UTSW	7	123192613	missense	probably damaging	0.99
R4967:Tnrc6a	UTSW	7	123189872	missense	probably damaging	1.00
R5064:Tnrc6a	UTSW	7	123186723	critical splice donor site	probably null
R5239:Tnrc6a	UTSW	7	123186619	missense	probably benign
R5604:Tnrc6a	UTSW	7	123174236	missense	probably damaging	0.97
R5805:Tnrc6a	UTSW	7	123170076	missense	probably damaging	0.97
R5942:Tnrc6a	UTSW	7	123186665	missense	probably damaging	1.00
R5988:Tnrc6a	UTSW	7	123182380	missense	probably damaging	0.96
R6212:Tnrc6a	UTSW	7	123143742	splice site	probably null
R6284:Tnrc6a	UTSW	7	123171335	missense	probably damaging	0.99
R6417:Tnrc6a	UTSW	7	123171074	missense	probably benign	0.01
R6420:Tnrc6a	UTSW	7	123171074	missense	probably benign	0.01
R6575:Tnrc6a	UTSW	7	123169910	missense	probably damaging	1.00
R6760:Tnrc6a	UTSW	7	123171999	missense	probably damaging	1.00
R6886:Tnrc6a	UTSW	7	123187445	missense	probably benign	0.17
R6968:Tnrc6a	UTSW	7	123182427	missense	probably benign	0.05
R7216:Tnrc6a	UTSW	7	123171495	missense	probably benign	0.01
R7260:Tnrc6a	UTSW	7	123186590	missense	probably benign	0.36
R7299:Tnrc6a	UTSW	7	123170913	missense	probably benign
R7322:Tnrc6a	UTSW	7	123171508	missense	probably benign	0.09
R7500:Tnrc6a	UTSW	7	123173450	splice site	probably null
R7872:Tnrc6a	UTSW	7	123179834	missense	probably damaging	0.99
R8270:Tnrc6a	UTSW	7	123170071	missense	possibly damaging	0.92
R8313:Tnrc6a	UTSW	7	123170713	missense	possibly damaging	0.92
R8348:Tnrc6a	UTSW	7	123192123	missense	possibly damaging	0.65
R8390:Tnrc6a	UTSW	7	123162571	missense	probably damaging	0.97
R8448:Tnrc6a	UTSW	7	123192123	missense	possibly damaging	0.65
R8514:Tnrc6a	UTSW	7	123184215	nonsense	probably null
R8552:Tnrc6a	UTSW	7	123162446	splice site	probably benign
R8767:Tnrc6a	UTSW	7	123183910	unclassified	probably benign
R9047:Tnrc6a	UTSW	7	123179723	missense	probably damaging	1.00
R9147:Tnrc6a	UTSW	7	123186444	intron	probably benign
R9153:Tnrc6a	UTSW	7	123174296	missense	probably damaging	1.00
R9166:Tnrc6a	UTSW	7	123187401	missense	probably damaging	1.00
R9179:Tnrc6a	UTSW	7	123192658	missense	probably benign	0.44
R9192:Tnrc6a	UTSW	7	123189953	missense	probably damaging	1.00
R9457:Tnrc6a	UTSW	7	123179735	missense	probably benign	0.24
R9778:Tnrc6a	UTSW	7	123170412	missense	probably benign	0.43
X0064:Tnrc6a	UTSW	7	123169798	missense	probably benign	0.28
Z1176:Tnrc6a	UTSW	7	123162496	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGGGGAGAATCTTCCAGG -3'
(R):5'- ATAGATTCTGGGGATGGCTCC -3'

Sequencing Primer
(F):5'- ATCTTCCAGGAGTAACCATTGGG -3'
(R):5'- AATAGGTCCCCCGAGCCAG -3'

Posted On

2015-06-12