Incidental Mutation 'R4235:Lamp1'
ID321070
Institutional Source Beutler Lab
Gene Symbol Lamp1
Ensembl Gene ENSMUSG00000031447
Gene Namelysosomal-associated membrane protein 1
SynonymsLamp-1, CD107a
MMRRC Submission 041052-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4235 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13159161-13175338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13167192 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 67 (V67A)
Ref Sequence ENSEMBL: ENSMUSP00000033824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033824] [ENSMUST00000209895]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033824
AA Change: V67A

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033824
Gene: ENSMUSG00000031447
AA Change: V67A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Lamp 106 406 4.8e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209895
Meta Mutation Damage Score 0.0795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. It may also play a role in tumor cell metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
5730596B20Rik G T 6: 52,178,961 probably benign Het
9530053A07Rik T A 7: 28,156,648 D1953E probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Bnc2 A G 4: 84,293,514 V231A probably damaging Het
Bod1l A G 5: 41,821,455 S839P probably damaging Het
Casp8 T A 1: 58,833,698 H264Q possibly damaging Het
Cc2d1b A T 4: 108,625,352 probably benign Het
Cpne6 A T 14: 55,513,600 probably benign Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dgkd T A 1: 87,931,982 L774* probably null Het
Fbxl2 T A 9: 113,989,163 N205I probably benign Het
Fkbp15 A T 4: 62,336,456 I269K probably benign Het
Gm13023 G C 4: 143,794,774 C320S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Has1 G T 17: 17,850,036 R208S possibly damaging Het
Hecw1 C G 13: 14,317,139 A423P probably benign Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Ifi208 T G 1: 173,682,911 S211A probably benign Het
Ighv6-3 T C 12: 114,391,874 E65G probably damaging Het
Igkv9-120 A T 6: 68,050,333 D77V probably benign Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm2a A G 19: 4,322,521 I932T probably damaging Het
Krt17 T C 11: 100,257,868 T279A possibly damaging Het
Limk1 T C 5: 134,670,478 I142V probably benign Het
Mamdc2 T C 19: 23,374,017 N182D possibly damaging Het
Mcpt1 G A 14: 56,018,560 probably null Het
Med12l T G 3: 59,257,223 probably null Het
Mfsd10 G T 5: 34,635,625 T44N probably damaging Het
Mrps27 T C 13: 99,405,041 S218P probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Neil2 A C 14: 63,191,841 M1R probably null Het
Nelfcd T C 2: 174,427,048 F587L probably damaging Het
Nfil3 T C 13: 52,968,799 D23G probably benign Het
Nit2 T C 16: 57,157,160 K169R probably benign Het
Nxt1 T C 2: 148,675,347 S3P probably benign Het
Ogt A G X: 101,667,525 N434D probably damaging Het
Olfr679 T A 7: 105,085,787 S24T possibly damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rsl1 T C 13: 67,177,162 probably null Het
Sobp G A 10: 43,022,900 H230Y probably damaging Het
Sptan1 A G 2: 30,026,588 E2096G probably damaging Het
Tie1 G T 4: 118,478,405 S797* probably null Het
Tmem266 T C 9: 55,418,107 I186T probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tnfaip6 T C 2: 52,050,864 F139S probably damaging Het
Tnrc6a T C 7: 123,171,680 S898P probably benign Het
Trim24 A G 6: 37,964,740 D911G probably damaging Het
Tyw5 T C 1: 57,388,488 probably benign Het
Ubr3 C T 2: 70,016,385 Q1651* probably null Het
Unc13c T A 9: 73,530,952 I1943F possibly damaging Het
Usp47 T A 7: 112,110,048 S1334T probably damaging Het
Vmn1r215 T A 13: 23,075,931 V47E probably benign Het
Vmn1r224 T A 17: 20,419,362 M67K possibly damaging Het
Wdfy3 T A 5: 101,922,634 probably null Het
Zfc3h1 T C 10: 115,418,799 Y1433H probably benign Het
Other mutations in Lamp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Lamp1 APN 8 13171195 unclassified probably benign
IGL01516:Lamp1 APN 8 13173863 missense probably damaging 0.98
IGL01541:Lamp1 APN 8 13165905 missense probably damaging 1.00
R0106:Lamp1 UTSW 8 13174550 missense probably damaging 1.00
R0106:Lamp1 UTSW 8 13174550 missense probably damaging 1.00
R0127:Lamp1 UTSW 8 13174491 missense probably damaging 1.00
R0744:Lamp1 UTSW 8 13172654 missense probably damaging 1.00
R0836:Lamp1 UTSW 8 13172654 missense probably damaging 1.00
R1875:Lamp1 UTSW 8 13167257 missense probably damaging 1.00
R1945:Lamp1 UTSW 8 13172545 missense probably benign 0.40
R2887:Lamp1 UTSW 8 13173891 missense probably damaging 1.00
R2888:Lamp1 UTSW 8 13173891 missense probably damaging 1.00
R2889:Lamp1 UTSW 8 13173891 missense probably damaging 1.00
R2890:Lamp1 UTSW 8 13173891 missense probably damaging 1.00
R4817:Lamp1 UTSW 8 13172541 missense probably benign 0.43
R5654:Lamp1 UTSW 8 13171388 splice site probably null
R5942:Lamp1 UTSW 8 13173941 missense probably damaging 1.00
R6538:Lamp1 UTSW 8 13171285 missense probably benign 0.00
R6917:Lamp1 UTSW 8 13172563 missense probably damaging 1.00
R6977:Lamp1 UTSW 8 13173661 missense probably damaging 0.98
R7262:Lamp1 UTSW 8 13167296 missense probably benign 0.01
R7680:Lamp1 UTSW 8 13167812 missense probably benign
R8123:Lamp1 UTSW 8 13167158 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGCACCAAGTAAGAGTCTC -3'
(R):5'- AAGGCAAGTTCTTTACCCTTCC -3'

Sequencing Primer
(F):5'- AAGAGTCTCTGTGAATGGCTAC -3'
(R):5'- ACAGAAGTCTTACCTTTGCTGATGG -3'
Posted On2015-06-12