Mutagenetix > Incidental Mutations

Incidental Mutation 'R4235:Impg1'

321074

Institutional Source

Beutler Lab

Gene Symbol

Impg1

Ensembl Gene

ENSMUSG00000032343

Gene Name

interphotoreceptor matrix proteoglycan 1

Synonyms

IMP150, SPACR, A930015H12Rik

MMRRC Submission

041052-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R4235 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80313330-80465481 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80345329 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 523 (L523P)

Ref Sequence

ENSEMBL: ENSMUSP00000108876 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085289] [ENSMUST00000113250]

Predicted Effect

probably damaging
Transcript: ENSMUST00000085289
AA Change: L446P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082395
Gene: ENSMUSG00000032343
AA Change: L446P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
SEA	158	273	8.68e-1	SMART
low complexity region	353	374	N/A	INTRINSIC
SEA	494	616	1.37e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113250
AA Change: L523P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108876
Gene: ENSMUSG00000032343
AA Change: L523P

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
SEA	235	350	8.68e-1	SMART
low complexity region	430	451	N/A	INTRINSIC
SEA	571	693	1.37e-11	SMART

Meta Mutation Damage Score

0.2382

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a major component of the retinal interphotoreceptor matrix. The encoded protein is a proteoglycan that is thought to play a role in maintaining viability of photoreceptor cells and in adhesion of the neural retina to the retinal pigment epithelium. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
5730596B20Rik	G	T	6: 52,178,961		probably benign	Het
9530053A07Rik	T	A	7: 28,156,648	D1953E	probably damaging	Het
Akap6	T	A	12: 53,139,671	N1289K	probably damaging	Het
Arhgap21	A	G	2: 20,887,137	V161A	probably damaging	Het
Arhgef18	T	C	8: 3,450,317	I541T	possibly damaging	Het
Atp7b	A	G	8: 22,011,023	Y955H	possibly damaging	Het
Bnc2	A	G	4: 84,293,514	V231A	probably damaging	Het
Bod1l	A	G	5: 41,821,455	S839P	probably damaging	Het
Casp8	T	A	1: 58,833,698	H264Q	possibly damaging	Het
Cc2d1b	A	T	4: 108,625,352		probably benign	Het
Cpne6	A	T	14: 55,513,600		probably benign	Het
Ddx1	C	T	12: 13,223,857	V590I	possibly damaging	Het
Dgkd	T	A	1: 87,931,982	L774*	probably null	Het
Fbxl2	T	A	9: 113,989,163	N205I	probably benign	Het
Fkbp15	A	T	4: 62,336,456	I269K	probably benign	Het
Gm13023	G	C	4: 143,794,774	C320S	probably damaging	Het
Gm26678	T	C	3: 54,633,083		noncoding transcript	Het
Has1	G	T	17: 17,850,036	R208S	possibly damaging	Het
Hecw1	C	G	13: 14,317,139	A423P	probably benign	Het
Hspa12b	T	C	2: 131,139,012	V162A	probably benign	Het
Ifi208	T	G	1: 173,682,911	S211A	probably benign	Het
Ighv6-3	T	C	12: 114,391,874	E65G	probably damaging	Het
Igkv9-120	A	T	6: 68,050,333	D77V	probably benign	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Kdm2a	A	G	19: 4,322,521	I932T	probably damaging	Het
Krt17	T	C	11: 100,257,868	T279A	possibly damaging	Het
Lamp1	T	C	8: 13,167,192	V67A	possibly damaging	Het
Limk1	T	C	5: 134,670,478	I142V	probably benign	Het
Mamdc2	T	C	19: 23,374,017	N182D	possibly damaging	Het
Mcpt1	G	A	14: 56,018,560		probably null	Het
Med12l	T	G	3: 59,257,223		probably null	Het
Mfsd10	G	T	5: 34,635,625	T44N	probably damaging	Het
Mrps27	T	C	13: 99,405,041	S218P	probably damaging	Het
Mrps30	T	C	13: 118,386,840	D132G	probably damaging	Het
Neil2	A	C	14: 63,191,841	M1R	probably null	Het
Nelfcd	T	C	2: 174,427,048	F587L	probably damaging	Het
Nfil3	T	C	13: 52,968,799	D23G	probably benign	Het
Nit2	T	C	16: 57,157,160	K169R	probably benign	Het
Nxt1	T	C	2: 148,675,347	S3P	probably benign	Het
Ogt	A	G	X: 101,667,525	N434D	probably damaging	Het
Olfr679	T	A	7: 105,085,787	S24T	possibly damaging	Het
Pcdhga5	A	G	18: 37,695,948	D483G	possibly damaging	Het
Ralgapa1	C	T	12: 55,640,644	R2019Q	probably damaging	Het
Rsl1	T	C	13: 67,177,162		probably null	Het
Sobp	G	A	10: 43,022,900	H230Y	probably damaging	Het
Sptan1	A	G	2: 30,026,588	E2096G	probably damaging	Het
Tie1	G	T	4: 118,478,405	S797*	probably null	Het
Tmem266	T	C	9: 55,418,107	I186T	probably damaging	Het
Tmem38b	T	C	4: 53,840,710	C66R	probably damaging	Het
Tnfaip6	T	C	2: 52,050,864	F139S	probably damaging	Het
Tnrc6a	T	C	7: 123,171,680	S898P	probably benign	Het
Trim24	A	G	6: 37,964,740	D911G	probably damaging	Het
Tyw5	T	C	1: 57,388,488		probably benign	Het
Ubr3	C	T	2: 70,016,385	Q1651*	probably null	Het
Unc13c	T	A	9: 73,530,952	I1943F	possibly damaging	Het
Usp47	T	A	7: 112,110,048	S1334T	probably damaging	Het
Vmn1r215	T	A	13: 23,075,931	V47E	probably benign	Het
Vmn1r224	T	A	17: 20,419,362	M67K	possibly damaging	Het
Wdfy3	T	A	5: 101,922,634		probably null	Het
Zfc3h1	T	C	10: 115,418,799	Y1433H	probably benign	Het

Other mutations in Impg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Impg1	APN	9	80322829	missense	probably benign	0.02
IGL01733:Impg1	APN	9	80341924	missense	probably damaging	0.99
IGL02333:Impg1	APN	9	80440755	missense	possibly damaging	0.74
IGL03097:Impg1	UTSW	9	80379952	missense	possibly damaging	0.48
R0021:Impg1	UTSW	9	80435426	missense	probably damaging	1.00
R0029:Impg1	UTSW	9	80398371	missense	probably damaging	1.00
R0029:Impg1	UTSW	9	80398371	missense	probably damaging	1.00
R0108:Impg1	UTSW	9	80322848	missense	possibly damaging	0.63
R0201:Impg1	UTSW	9	80345561	missense	probably damaging	1.00
R0271:Impg1	UTSW	9	80386879	splice site	probably benign
R0316:Impg1	UTSW	9	80342065	missense	probably damaging	1.00
R0492:Impg1	UTSW	9	80345308	missense	possibly damaging	0.74
R0633:Impg1	UTSW	9	80394155	missense	possibly damaging	0.72
R0705:Impg1	UTSW	9	80379979	missense	probably damaging	1.00
R0962:Impg1	UTSW	9	80381741	missense	probably benign	0.23
R1264:Impg1	UTSW	9	80314393	missense	probably benign	0.31
R1707:Impg1	UTSW	9	80378517	splice site	probably null
R2017:Impg1	UTSW	9	80440667	missense	probably damaging	1.00
R3904:Impg1	UTSW	9	80345585	missense	possibly damaging	0.76
R3960:Impg1	UTSW	9	80440864	missense	probably benign	0.00
R4231:Impg1	UTSW	9	80345329	missense	probably damaging	1.00
R4233:Impg1	UTSW	9	80345329	missense	probably damaging	1.00
R4236:Impg1	UTSW	9	80345329	missense	probably damaging	1.00
R4490:Impg1	UTSW	9	80394059	missense	probably damaging	1.00
R4592:Impg1	UTSW	9	80440854	missense	probably benign	0.05
R4701:Impg1	UTSW	9	80314400	missense	probably benign	0.07
R4785:Impg1	UTSW	9	80398450	missense	probably benign	0.01
R4796:Impg1	UTSW	9	80394095	missense	probably damaging	0.99
R4923:Impg1	UTSW	9	80345078	nonsense	probably null
R4923:Impg1	UTSW	9	80345545	missense	probably damaging	0.98
R5468:Impg1	UTSW	9	80465265	missense	probably benign	0.05
R5596:Impg1	UTSW	9	80345218	missense	probably benign	0.24
R6001:Impg1	UTSW	9	80316172	missense	probably benign	0.12
R6156:Impg1	UTSW	9	80322824	missense	probably damaging	1.00
R6315:Impg1	UTSW	9	80394074	missense	probably benign	0.21
R6419:Impg1	UTSW	9	80380018	missense	probably benign	0.38
R6880:Impg1	UTSW	9	80404800	missense	probably damaging	1.00
R7013:Impg1	UTSW	9	80378494	missense	probably damaging	1.00
Z1176:Impg1	UTSW	9	80378467	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- GAATACCACTAGCTCCTGGC -3'
(R):5'- TCAGCCTCAATTTCCCGATCAG -3'

Sequencing Primer
(F):5'- CCCTTGGTGGCAATGGTCTC -3'
(R):5'- TTCCCGATCAGAAAATCTACCTTCG -3'

Posted On

2015-06-12