Incidental Mutation 'R4235:Fbxl2'
ID321076
Institutional Source Beutler Lab
Gene Symbol Fbxl2
Ensembl Gene ENSMUSG00000032507
Gene NameF-box and leucine-rich repeat protein 2
Synonyms2810423A21Rik, Fbl3
MMRRC Submission 041052-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4235 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location113963637-114046191 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113989163 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 205 (N205I)
Ref Sequence ENSEMBL: ENSMUSP00000114075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035090] [ENSMUST00000117537] [ENSMUST00000143180]
Predicted Effect probably benign
Transcript: ENSMUST00000035090
AA Change: N205I

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000035090
Gene: ENSMUSG00000032507
AA Change: N205I

DomainStartEndE-ValueType
FBOX 15 55 1.18e-6 SMART
LRR 77 102 1.16e-1 SMART
LRR 103 128 5.21e-4 SMART
LRR 129 154 2.24e-3 SMART
LRR_CC 155 180 5.46e-7 SMART
LRR 181 206 7.05e-1 SMART
LRR 207 232 4.87e-4 SMART
LRR 233 258 1.5e-4 SMART
LRR 259 284 8.81e-2 SMART
LRR 285 310 2.05e-2 SMART
LRR_CC 311 336 6.37e-8 SMART
LRR 365 391 2.44e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117537
AA Change: N205I

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000114075
Gene: ENSMUSG00000032507
AA Change: N205I

DomainStartEndE-ValueType
FBOX 15 55 1.18e-6 SMART
LRR 77 102 1.16e-1 SMART
LRR 103 128 5.21e-4 SMART
LRR 129 154 2.24e-3 SMART
LRR_CC 155 180 5.46e-7 SMART
LRR 181 206 7.05e-1 SMART
LRR 207 232 4.87e-4 SMART
LRR 233 258 1.5e-4 SMART
LRR 259 284 8.81e-2 SMART
LRR 285 310 2.05e-2 SMART
LRR_CC 311 336 6.37e-8 SMART
LRR 365 391 2.44e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127352
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139757
Predicted Effect probably benign
Transcript: ENSMUST00000143180
Meta Mutation Damage Score 0.1044 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains 12 tandem leucine-rich repeats. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
5730596B20Rik G T 6: 52,178,961 probably benign Het
9530053A07Rik T A 7: 28,156,648 D1953E probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Bnc2 A G 4: 84,293,514 V231A probably damaging Het
Bod1l A G 5: 41,821,455 S839P probably damaging Het
Casp8 T A 1: 58,833,698 H264Q possibly damaging Het
Cc2d1b A T 4: 108,625,352 probably benign Het
Cpne6 A T 14: 55,513,600 probably benign Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dgkd T A 1: 87,931,982 L774* probably null Het
Fkbp15 A T 4: 62,336,456 I269K probably benign Het
Gm13023 G C 4: 143,794,774 C320S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Has1 G T 17: 17,850,036 R208S possibly damaging Het
Hecw1 C G 13: 14,317,139 A423P probably benign Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Ifi208 T G 1: 173,682,911 S211A probably benign Het
Ighv6-3 T C 12: 114,391,874 E65G probably damaging Het
Igkv9-120 A T 6: 68,050,333 D77V probably benign Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm2a A G 19: 4,322,521 I932T probably damaging Het
Krt17 T C 11: 100,257,868 T279A possibly damaging Het
Lamp1 T C 8: 13,167,192 V67A possibly damaging Het
Limk1 T C 5: 134,670,478 I142V probably benign Het
Mamdc2 T C 19: 23,374,017 N182D possibly damaging Het
Mcpt1 G A 14: 56,018,560 probably null Het
Med12l T G 3: 59,257,223 probably null Het
Mfsd10 G T 5: 34,635,625 T44N probably damaging Het
Mrps27 T C 13: 99,405,041 S218P probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Neil2 A C 14: 63,191,841 M1R probably null Het
Nelfcd T C 2: 174,427,048 F587L probably damaging Het
Nfil3 T C 13: 52,968,799 D23G probably benign Het
Nit2 T C 16: 57,157,160 K169R probably benign Het
Nxt1 T C 2: 148,675,347 S3P probably benign Het
Ogt A G X: 101,667,525 N434D probably damaging Het
Olfr679 T A 7: 105,085,787 S24T possibly damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rsl1 T C 13: 67,177,162 probably null Het
Sobp G A 10: 43,022,900 H230Y probably damaging Het
Sptan1 A G 2: 30,026,588 E2096G probably damaging Het
Tie1 G T 4: 118,478,405 S797* probably null Het
Tmem266 T C 9: 55,418,107 I186T probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tnfaip6 T C 2: 52,050,864 F139S probably damaging Het
Tnrc6a T C 7: 123,171,680 S898P probably benign Het
Trim24 A G 6: 37,964,740 D911G probably damaging Het
Tyw5 T C 1: 57,388,488 probably benign Het
Ubr3 C T 2: 70,016,385 Q1651* probably null Het
Unc13c T A 9: 73,530,952 I1943F possibly damaging Het
Usp47 T A 7: 112,110,048 S1334T probably damaging Het
Vmn1r215 T A 13: 23,075,931 V47E probably benign Het
Vmn1r224 T A 17: 20,419,362 M67K possibly damaging Het
Wdfy3 T A 5: 101,922,634 probably null Het
Zfc3h1 T C 10: 115,418,799 Y1433H probably benign Het
Other mutations in Fbxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Fbxl2 APN 9 113983979 splice site probably benign
IGL02165:Fbxl2 APN 9 114018031 missense probably benign 0.06
IGL02535:Fbxl2 APN 9 113979507 missense probably benign 0.25
R0145:Fbxl2 UTSW 9 113985325 missense probably damaging 1.00
R1668:Fbxl2 UTSW 9 113989146 missense probably benign 0.00
R1694:Fbxl2 UTSW 9 114003171 missense probably damaging 0.99
R1964:Fbxl2 UTSW 9 113989169 missense probably benign 0.00
R2993:Fbxl2 UTSW 9 113989416 missense possibly damaging 0.48
R3894:Fbxl2 UTSW 9 114003193 missense probably damaging 1.00
R4342:Fbxl2 UTSW 9 113985306 missense probably benign
R5310:Fbxl2 UTSW 9 113986508 missense possibly damaging 0.78
R5509:Fbxl2 UTSW 9 113985347 splice site probably null
R5696:Fbxl2 UTSW 9 113986478 missense probably damaging 1.00
R6232:Fbxl2 UTSW 9 113986448 missense probably damaging 0.98
R6371:Fbxl2 UTSW 9 113989383 missense probably damaging 1.00
R6803:Fbxl2 UTSW 9 113984549 missense probably damaging 1.00
R7530:Fbxl2 UTSW 9 113989173 missense probably benign 0.01
Z1177:Fbxl2 UTSW 9 113989345 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTTGGGTATATGCAGCCTG -3'
(R):5'- TTTGAAAGCCCTGCTCCTG -3'

Sequencing Primer
(F):5'- ACAGTGGGGCCGTGCATAG -3'
(R):5'- CTCCTGAGGGGTTGTACACAG -3'
Posted On2015-06-12