Incidental Mutation 'R4235:Zfc3h1'
ID 321078
Institutional Source Beutler Lab
Gene Symbol Zfc3h1
Ensembl Gene ENSMUSG00000034163
Gene Name zinc finger, C3H1-type containing
Synonyms Ccdc131, Psrc2
MMRRC Submission 041052-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock # R4235 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 115384959-115432772 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115418799 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1433 (Y1433H)
Ref Sequence ENSEMBL: ENSMUSP00000044069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036044]
AlphaFold B2RT41
Predicted Effect probably benign
Transcript: ENSMUST00000036044
AA Change: Y1433H

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044069
Gene: ENSMUSG00000034163
AA Change: Y1433H

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 29 90 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
low complexity region 143 214 N/A INTRINSIC
coiled coil region 361 393 N/A INTRINSIC
low complexity region 399 432 N/A INTRINSIC
coiled coil region 436 491 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 564 583 N/A INTRINSIC
low complexity region 595 619 N/A INTRINSIC
low complexity region 623 636 N/A INTRINSIC
low complexity region 716 729 N/A INTRINSIC
low complexity region 752 763 N/A INTRINSIC
coiled coil region 826 889 N/A INTRINSIC
coiled coil region 968 1000 N/A INTRINSIC
low complexity region 1001 1015 N/A INTRINSIC
Pfam:zf-C3H1 1187 1208 1.3e-11 PFAM
HAT 1384 1416 1.11e0 SMART
HAT 1418 1449 4.35e2 SMART
Blast:HAT 1495 1538 2e-9 BLAST
HAT 1653 1685 3.31e1 SMART
HAT 1762 1797 7.03e1 SMART
HAT 1922 1954 1.29e-1 SMART
low complexity region 1975 1992 N/A INTRINSIC
Meta Mutation Damage Score 0.0619 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
5730596B20Rik G T 6: 52,178,961 probably benign Het
9530053A07Rik T A 7: 28,156,648 D1953E probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Bnc2 A G 4: 84,293,514 V231A probably damaging Het
Bod1l A G 5: 41,821,455 S839P probably damaging Het
Casp8 T A 1: 58,833,698 H264Q possibly damaging Het
Cc2d1b A T 4: 108,625,352 probably benign Het
Cpne6 A T 14: 55,513,600 probably benign Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dgkd T A 1: 87,931,982 L774* probably null Het
Fbxl2 T A 9: 113,989,163 N205I probably benign Het
Fkbp15 A T 4: 62,336,456 I269K probably benign Het
Gm13023 G C 4: 143,794,774 C320S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Has1 G T 17: 17,850,036 R208S possibly damaging Het
Hecw1 C G 13: 14,317,139 A423P probably benign Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Ifi208 T G 1: 173,682,911 S211A probably benign Het
Ighv6-3 T C 12: 114,391,874 E65G probably damaging Het
Igkv9-120 A T 6: 68,050,333 D77V probably benign Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm2a A G 19: 4,322,521 I932T probably damaging Het
Krt17 T C 11: 100,257,868 T279A possibly damaging Het
Lamp1 T C 8: 13,167,192 V67A possibly damaging Het
Limk1 T C 5: 134,670,478 I142V probably benign Het
Mamdc2 T C 19: 23,374,017 N182D possibly damaging Het
Mcpt1 G A 14: 56,018,560 probably null Het
Med12l T G 3: 59,257,223 probably null Het
Mfsd10 G T 5: 34,635,625 T44N probably damaging Het
Mrps27 T C 13: 99,405,041 S218P probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Neil2 A C 14: 63,191,841 M1R probably null Het
Nelfcd T C 2: 174,427,048 F587L probably damaging Het
Nfil3 T C 13: 52,968,799 D23G probably benign Het
Nit2 T C 16: 57,157,160 K169R probably benign Het
Nxt1 T C 2: 148,675,347 S3P probably benign Het
Ogt A G X: 101,667,525 N434D probably damaging Het
Olfr679 T A 7: 105,085,787 S24T possibly damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rsl1 T C 13: 67,177,162 probably null Het
Sobp G A 10: 43,022,900 H230Y probably damaging Het
Sptan1 A G 2: 30,026,588 E2096G probably damaging Het
Tie1 G T 4: 118,478,405 S797* probably null Het
Tmem266 T C 9: 55,418,107 I186T probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tnfaip6 T C 2: 52,050,864 F139S probably damaging Het
Tnrc6a T C 7: 123,171,680 S898P probably benign Het
Trim24 A G 6: 37,964,740 D911G probably damaging Het
Tyw5 T C 1: 57,388,488 probably benign Het
Ubr3 C T 2: 70,016,385 Q1651* probably null Het
Unc13c T A 9: 73,530,952 I1943F possibly damaging Het
Usp47 T A 7: 112,110,048 S1334T probably damaging Het
Vmn1r215 T A 13: 23,075,931 V47E probably benign Het
Vmn1r224 T A 17: 20,419,362 M67K possibly damaging Het
Wdfy3 T A 5: 101,922,634 probably null Het
Other mutations in Zfc3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00698:Zfc3h1 APN 10 115419832 missense possibly damaging 0.92
IGL00793:Zfc3h1 APN 10 115416874 missense probably benign 0.00
IGL01349:Zfc3h1 APN 10 115423448 missense probably damaging 1.00
IGL01431:Zfc3h1 APN 10 115423223 missense possibly damaging 0.49
IGL02273:Zfc3h1 APN 10 115427099 missense probably benign
IGL02382:Zfc3h1 APN 10 115416876 nonsense probably null
IGL02397:Zfc3h1 APN 10 115407985 missense probably damaging 1.00
IGL02657:Zfc3h1 APN 10 115411954 missense possibly damaging 0.48
IGL02826:Zfc3h1 APN 10 115400904 missense probably benign 0.42
Gnatcatcher UTSW 10 115400742 missense probably benign 0.39
hutton UTSW 10 115415248 missense probably damaging 0.96
R0178_Zfc3h1_655 UTSW 10 115406725 splice site probably benign
vireo UTSW 10 115419901 missense probably benign 0.01
warbler UTSW 10 115406483 missense probably damaging 1.00
PIT4260001:Zfc3h1 UTSW 10 115390889 missense probably damaging 0.99
PIT4354001:Zfc3h1 UTSW 10 115427039 nonsense probably null
R0062:Zfc3h1 UTSW 10 115416753 missense probably benign 0.00
R0062:Zfc3h1 UTSW 10 115416753 missense probably benign 0.00
R0067:Zfc3h1 UTSW 10 115423474 missense possibly damaging 0.88
R0067:Zfc3h1 UTSW 10 115423474 missense possibly damaging 0.88
R0104:Zfc3h1 UTSW 10 115415287 missense possibly damaging 0.66
R0178:Zfc3h1 UTSW 10 115406725 splice site probably benign
R0355:Zfc3h1 UTSW 10 115409113 missense possibly damaging 0.80
R0619:Zfc3h1 UTSW 10 115420810 missense possibly damaging 0.92
R0731:Zfc3h1 UTSW 10 115410632 missense probably benign 0.00
R0828:Zfc3h1 UTSW 10 115401707 missense possibly damaging 0.68
R0866:Zfc3h1 UTSW 10 115427716 missense probably benign 0.00
R1196:Zfc3h1 UTSW 10 115411961 missense probably damaging 0.99
R1455:Zfc3h1 UTSW 10 115412108 missense probably benign 0.11
R1515:Zfc3h1 UTSW 10 115416742 missense probably benign 0.29
R1617:Zfc3h1 UTSW 10 115390922 missense probably benign 0.01
R1640:Zfc3h1 UTSW 10 115406901 splice site probably null
R1959:Zfc3h1 UTSW 10 115423253 missense probably benign 0.34
R2039:Zfc3h1 UTSW 10 115406483 missense probably damaging 1.00
R3430:Zfc3h1 UTSW 10 115410523 splice site probably benign
R3691:Zfc3h1 UTSW 10 115420690 missense probably benign
R3909:Zfc3h1 UTSW 10 115419901 missense probably benign 0.01
R4684:Zfc3h1 UTSW 10 115423385 missense probably benign 0.03
R4816:Zfc3h1 UTSW 10 115415694 missense probably benign 0.16
R4881:Zfc3h1 UTSW 10 115400742 missense probably benign 0.39
R4883:Zfc3h1 UTSW 10 115410642 missense probably damaging 1.00
R5038:Zfc3h1 UTSW 10 115404211 missense probably benign 0.16
R5068:Zfc3h1 UTSW 10 115418783 nonsense probably null
R5069:Zfc3h1 UTSW 10 115418783 nonsense probably null
R5070:Zfc3h1 UTSW 10 115418783 nonsense probably null
R5155:Zfc3h1 UTSW 10 115412121 missense possibly damaging 0.64
R5190:Zfc3h1 UTSW 10 115418692 missense probably damaging 1.00
R5499:Zfc3h1 UTSW 10 115410693 missense probably damaging 1.00
R5932:Zfc3h1 UTSW 10 115400910 missense probably benign 0.44
R5935:Zfc3h1 UTSW 10 115431357 intron probably benign
R6165:Zfc3h1 UTSW 10 115420669 missense probably benign 0.30
R6182:Zfc3h1 UTSW 10 115390859 missense probably benign 0.00
R6262:Zfc3h1 UTSW 10 115413976 missense probably damaging 1.00
R6382:Zfc3h1 UTSW 10 115407908 missense probably benign 0.06
R6392:Zfc3h1 UTSW 10 115401748 missense probably damaging 1.00
R6539:Zfc3h1 UTSW 10 115412002 missense probably benign 0.26
R6723:Zfc3h1 UTSW 10 115420733 missense probably benign 0.34
R7339:Zfc3h1 UTSW 10 115403300 missense probably damaging 1.00
R7381:Zfc3h1 UTSW 10 115424630 missense probably benign
R7404:Zfc3h1 UTSW 10 115415248 missense probably damaging 0.96
R7667:Zfc3h1 UTSW 10 115410701 nonsense probably null
R7748:Zfc3h1 UTSW 10 115400815 missense probably benign 0.27
R7910:Zfc3h1 UTSW 10 115420683 nonsense probably null
R7914:Zfc3h1 UTSW 10 115403157 splice site probably null
R8023:Zfc3h1 UTSW 10 115420648 missense probably damaging 1.00
R8169:Zfc3h1 UTSW 10 115418711 missense probably damaging 0.98
R8358:Zfc3h1 UTSW 10 115404293 missense probably benign 0.13
R8746:Zfc3h1 UTSW 10 115407980 missense probably damaging 1.00
R8803:Zfc3h1 UTSW 10 115411895 missense probably benign
R8905:Zfc3h1 UTSW 10 115423478 missense probably benign 0.05
R9045:Zfc3h1 UTSW 10 115427414 missense possibly damaging 0.49
R9164:Zfc3h1 UTSW 10 115423469 missense probably benign 0.17
R9211:Zfc3h1 UTSW 10 115412423 missense possibly damaging 0.83
R9216:Zfc3h1 UTSW 10 115385623 missense unknown
R9305:Zfc3h1 UTSW 10 115419866 missense probably benign 0.19
R9372:Zfc3h1 UTSW 10 115385318 missense unknown
R9394:Zfc3h1 UTSW 10 115418695 missense probably damaging 1.00
R9414:Zfc3h1 UTSW 10 115414011 missense possibly damaging 0.56
Z1176:Zfc3h1 UTSW 10 115408002 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCTGTCTTTGAAACATACAGG -3'
(R):5'- ACCCCAATGTTTGAGTTTCAGAAAG -3'

Sequencing Primer
(F):5'- CCTGTCTTTGAAACATACAGGCTGTG -3'
(R):5'- AATCTGAGATAAAGCTGAGGAAAATC -3'
Posted On 2015-06-12