Incidental Mutation 'R4235:Ddx1'
ID321079
Institutional Source Beutler Lab
Gene Symbol Ddx1
Ensembl Gene ENSMUSG00000037149
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 1
Synonyms
MMRRC Submission 041052-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4235 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location13216973-13249213 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13223857 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 590 (V590I)
Ref Sequence ENSEMBL: ENSMUSP00000065987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071103]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071103
AA Change: V590I

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000065987
Gene: ENSMUSG00000037149
AA Change: V590I

DomainStartEndE-ValueType
DEXDc 21 444 1.95e-47 SMART
SPRY 130 246 1.91e-34 SMART
HELICc 520 610 8.28e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221028
Meta Mutation Damage Score 0.1872 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein of unknown function. It shows high transcription levels in 2 retinoblastoma cell lines and in tissues of neuroectodermal origin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
5730596B20Rik G T 6: 52,178,961 probably benign Het
9530053A07Rik T A 7: 28,156,648 D1953E probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Bnc2 A G 4: 84,293,514 V231A probably damaging Het
Bod1l A G 5: 41,821,455 S839P probably damaging Het
Casp8 T A 1: 58,833,698 H264Q possibly damaging Het
Cc2d1b A T 4: 108,625,352 probably benign Het
Cpne6 A T 14: 55,513,600 probably benign Het
Dgkd T A 1: 87,931,982 L774* probably null Het
Fbxl2 T A 9: 113,989,163 N205I probably benign Het
Fkbp15 A T 4: 62,336,456 I269K probably benign Het
Gm13023 G C 4: 143,794,774 C320S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Has1 G T 17: 17,850,036 R208S possibly damaging Het
Hecw1 C G 13: 14,317,139 A423P probably benign Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Ifi208 T G 1: 173,682,911 S211A probably benign Het
Ighv6-3 T C 12: 114,391,874 E65G probably damaging Het
Igkv9-120 A T 6: 68,050,333 D77V probably benign Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm2a A G 19: 4,322,521 I932T probably damaging Het
Krt17 T C 11: 100,257,868 T279A possibly damaging Het
Lamp1 T C 8: 13,167,192 V67A possibly damaging Het
Limk1 T C 5: 134,670,478 I142V probably benign Het
Mamdc2 T C 19: 23,374,017 N182D possibly damaging Het
Mcpt1 G A 14: 56,018,560 probably null Het
Med12l T G 3: 59,257,223 probably null Het
Mfsd10 G T 5: 34,635,625 T44N probably damaging Het
Mrps27 T C 13: 99,405,041 S218P probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Neil2 A C 14: 63,191,841 M1R probably null Het
Nelfcd T C 2: 174,427,048 F587L probably damaging Het
Nfil3 T C 13: 52,968,799 D23G probably benign Het
Nit2 T C 16: 57,157,160 K169R probably benign Het
Nxt1 T C 2: 148,675,347 S3P probably benign Het
Ogt A G X: 101,667,525 N434D probably damaging Het
Olfr679 T A 7: 105,085,787 S24T possibly damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rsl1 T C 13: 67,177,162 probably null Het
Sobp G A 10: 43,022,900 H230Y probably damaging Het
Sptan1 A G 2: 30,026,588 E2096G probably damaging Het
Tie1 G T 4: 118,478,405 S797* probably null Het
Tmem266 T C 9: 55,418,107 I186T probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tnfaip6 T C 2: 52,050,864 F139S probably damaging Het
Tnrc6a T C 7: 123,171,680 S898P probably benign Het
Trim24 A G 6: 37,964,740 D911G probably damaging Het
Tyw5 T C 1: 57,388,488 probably benign Het
Ubr3 C T 2: 70,016,385 Q1651* probably null Het
Unc13c T A 9: 73,530,952 I1943F possibly damaging Het
Usp47 T A 7: 112,110,048 S1334T probably damaging Het
Vmn1r215 T A 13: 23,075,931 V47E probably benign Het
Vmn1r224 T A 17: 20,419,362 M67K possibly damaging Het
Wdfy3 T A 5: 101,922,634 probably null Het
Zfc3h1 T C 10: 115,418,799 Y1433H probably benign Het
Other mutations in Ddx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Ddx1 APN 12 13227459 splice site probably benign
IGL00725:Ddx1 APN 12 13245690 missense probably damaging 1.00
IGL00958:Ddx1 APN 12 13240848 splice site probably null
IGL01786:Ddx1 APN 12 13229136 missense probably benign
IGL02832:Ddx1 APN 12 13227317 nonsense probably null
IGL02983:Ddx1 APN 12 13223862 missense probably damaging 1.00
R0201:Ddx1 UTSW 12 13223808 missense probably damaging 1.00
R0931:Ddx1 UTSW 12 13237817 splice site probably benign
R1434:Ddx1 UTSW 12 13237231 missense probably benign 0.01
R1558:Ddx1 UTSW 12 13239541 missense probably damaging 1.00
R1673:Ddx1 UTSW 12 13244966 critical splice donor site probably null
R1854:Ddx1 UTSW 12 13229331 missense probably benign 0.19
R2910:Ddx1 UTSW 12 13231440 splice site probably null
R2911:Ddx1 UTSW 12 13231440 splice site probably null
R4181:Ddx1 UTSW 12 13231503 nonsense probably null
R4182:Ddx1 UTSW 12 13231503 nonsense probably null
R4183:Ddx1 UTSW 12 13231503 nonsense probably null
R4231:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4234:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4243:Ddx1 UTSW 12 13240909 nonsense probably null
R4717:Ddx1 UTSW 12 13240887 missense probably damaging 1.00
R4821:Ddx1 UTSW 12 13239147 missense probably damaging 1.00
R5032:Ddx1 UTSW 12 13223992 missense probably damaging 1.00
R5082:Ddx1 UTSW 12 13220435 nonsense probably null
R5528:Ddx1 UTSW 12 13229294 missense probably damaging 1.00
R5997:Ddx1 UTSW 12 13237799 missense probably damaging 1.00
R6398:Ddx1 UTSW 12 13245720 missense probably damaging 1.00
R6891:Ddx1 UTSW 12 13236095 missense probably benign 0.25
R7085:Ddx1 UTSW 12 13229355 missense probably damaging 1.00
R7125:Ddx1 UTSW 12 13243863 missense probably benign 0.18
R7307:Ddx1 UTSW 12 13223959 missense probably damaging 1.00
R7388:Ddx1 UTSW 12 13225455 missense probably null 1.00
R7393:Ddx1 UTSW 12 13230353 missense probably benign 0.03
R7460:Ddx1 UTSW 12 13231439 splice site probably null
X0011:Ddx1 UTSW 12 13229415 missense probably damaging 1.00
X0028:Ddx1 UTSW 12 13243866 missense probably benign 0.00
Z1177:Ddx1 UTSW 12 13229259 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGCCACCAGGGAAATAGCC -3'
(R):5'- ACCATGTAGCTTTCTTAGTGGAG -3'

Sequencing Primer
(F):5'- GGGAAATAGCCAGGCCCATC -3'
(R):5'- GTTTTATGCATTCACTGACAGACACC -3'
Posted On2015-06-12