Mutagenetix > Incidental Mutation

Incidental Mutation 'R4235:Akap6'

321080

Institutional Source

Beutler Lab

Gene Symbol

Akap6

Ensembl Gene

ENSMUSG00000061603

Gene Name

A kinase (PRKA) anchor protein 6

Synonyms

MMRRC Submission

041052-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.843) question?

Stock #

R4235 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52699383-53155599 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 53139671 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1289 (N1289K)

Ref Sequence

ENSEMBL: ENSMUSP00000093406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]

AlphaFold

E9Q9K8

Predicted Effect

probably damaging
Transcript: ENSMUST00000095737
AA Change: N1289K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: N1289K

Domain	Start	End	E-Value	Type
low complexity region	34	51	N/A	INTRINSIC
Blast:SPEC	66	168	2e-50	BLAST
low complexity region	441	455	N/A	INTRINSIC
low complexity region	544	555	N/A	INTRINSIC
low complexity region	569	587	N/A	INTRINSIC
low complexity region	640	651	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
SPEC	779	880	1.06e-1	SMART
SPEC	959	1057	1.45e0	SMART
SPEC	1078	1185	2.56e-2	SMART
low complexity region	1316	1332	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1610	1622	N/A	INTRINSIC
low complexity region	1683	1698	N/A	INTRINSIC
low complexity region	1737	1781	N/A	INTRINSIC
low complexity region	1899	1910	N/A	INTRINSIC
low complexity region	2019	2031	N/A	INTRINSIC
low complexity region	2104	2115	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000219786

Meta Mutation Damage Score

0.2233

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
5730596B20Rik	G	T	6: 52,178,961		probably benign	Het
9530053A07Rik	T	A	7: 28,156,648	D1953E	probably damaging	Het
Arhgap21	A	G	2: 20,887,137	V161A	probably damaging	Het
Arhgef18	T	C	8: 3,450,317	I541T	possibly damaging	Het
Atp7b	A	G	8: 22,011,023	Y955H	possibly damaging	Het
Bnc2	A	G	4: 84,293,514	V231A	probably damaging	Het
Bod1l	A	G	5: 41,821,455	S839P	probably damaging	Het
Casp8	T	A	1: 58,833,698	H264Q	possibly damaging	Het
Cc2d1b	A	T	4: 108,625,352		probably benign	Het
Cpne6	A	T	14: 55,513,600		probably benign	Het
Ddx1	C	T	12: 13,223,857	V590I	possibly damaging	Het
Dgkd	T	A	1: 87,931,982	L774*	probably null	Het
Fbxl2	T	A	9: 113,989,163	N205I	probably benign	Het
Fkbp15	A	T	4: 62,336,456	I269K	probably benign	Het
Gm13023	G	C	4: 143,794,774	C320S	probably damaging	Het
Gm26678	T	C	3: 54,633,083		noncoding transcript	Het
Has1	G	T	17: 17,850,036	R208S	possibly damaging	Het
Hecw1	C	G	13: 14,317,139	A423P	probably benign	Het
Hspa12b	T	C	2: 131,139,012	V162A	probably benign	Het
Ifi208	T	G	1: 173,682,911	S211A	probably benign	Het
Ighv6-3	T	C	12: 114,391,874	E65G	probably damaging	Het
Igkv9-120	A	T	6: 68,050,333	D77V	probably benign	Het
Impg1	A	G	9: 80,345,329	L523P	probably damaging	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Kdm2a	A	G	19: 4,322,521	I932T	probably damaging	Het
Krt17	T	C	11: 100,257,868	T279A	possibly damaging	Het
Lamp1	T	C	8: 13,167,192	V67A	possibly damaging	Het
Limk1	T	C	5: 134,670,478	I142V	probably benign	Het
Mamdc2	T	C	19: 23,374,017	N182D	possibly damaging	Het
Mcpt1	G	A	14: 56,018,560		probably null	Het
Med12l	T	G	3: 59,257,223		probably null	Het
Mfsd10	G	T	5: 34,635,625	T44N	probably damaging	Het
Mrps27	T	C	13: 99,405,041	S218P	probably damaging	Het
Mrps30	T	C	13: 118,386,840	D132G	probably damaging	Het
Neil2	A	C	14: 63,191,841	M1R	probably null	Het
Nelfcd	T	C	2: 174,427,048	F587L	probably damaging	Het
Nfil3	T	C	13: 52,968,799	D23G	probably benign	Het
Nit2	T	C	16: 57,157,160	K169R	probably benign	Het
Nxt1	T	C	2: 148,675,347	S3P	probably benign	Het
Ogt	A	G	X: 101,667,525	N434D	probably damaging	Het
Olfr679	T	A	7: 105,085,787	S24T	possibly damaging	Het
Pcdhga5	A	G	18: 37,695,948	D483G	possibly damaging	Het
Ralgapa1	C	T	12: 55,640,644	R2019Q	probably damaging	Het
Rsl1	T	C	13: 67,177,162		probably null	Het
Sobp	G	A	10: 43,022,900	H230Y	probably damaging	Het
Sptan1	A	G	2: 30,026,588	E2096G	probably damaging	Het
Tie1	G	T	4: 118,478,405	S797*	probably null	Het
Tmem266	T	C	9: 55,418,107	I186T	probably damaging	Het
Tmem38b	T	C	4: 53,840,710	C66R	probably damaging	Het
Tnfaip6	T	C	2: 52,050,864	F139S	probably damaging	Het
Tnrc6a	T	C	7: 123,171,680	S898P	probably benign	Het
Trim24	A	G	6: 37,964,740	D911G	probably damaging	Het
Tyw5	T	C	1: 57,388,488		probably benign	Het
Ubr3	C	T	2: 70,016,385	Q1651*	probably null	Het
Unc13c	T	A	9: 73,530,952	I1943F	possibly damaging	Het
Usp47	T	A	7: 112,110,048	S1334T	probably damaging	Het
Vmn1r215	T	A	13: 23,075,931	V47E	probably benign	Het
Vmn1r224	T	A	17: 20,419,362	M67K	possibly damaging	Het
Wdfy3	T	A	5: 101,922,634		probably null	Het
Zfc3h1	T	C	10: 115,418,799	Y1433H	probably benign	Het

Other mutations in Akap6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Akap6	APN	12	53140980	missense	possibly damaging	0.79
IGL00505:Akap6	APN	12	52887102	missense	possibly damaging	0.92
IGL01134:Akap6	APN	12	52937217	missense	probably damaging	0.96
IGL01458:Akap6	APN	12	52886818	nonsense	probably null
IGL01589:Akap6	APN	12	53139664	missense	probably damaging	1.00
IGL01592:Akap6	APN	12	53142142	missense	probably damaging	1.00
IGL01738:Akap6	APN	12	52886817	missense	probably damaging	0.99
IGL01867:Akap6	APN	12	52888008	missense	probably damaging	1.00
IGL02025:Akap6	APN	12	53140335	missense	probably benign
IGL02041:Akap6	APN	12	53140653	missense	probably damaging	1.00
IGL02058:Akap6	APN	12	53140555	missense	probably damaging	1.00
IGL02194:Akap6	APN	12	52886823	missense	probably benign	0.00
IGL02226:Akap6	APN	12	53010467	splice site	probably benign
IGL02323:Akap6	APN	12	53140429	missense	probably benign	0.00
IGL02449:Akap6	APN	12	53140188	missense	probably damaging	1.00
IGL02475:Akap6	APN	12	53139494	missense	probably benign	0.03
IGL02546:Akap6	APN	12	52880738	missense	probably damaging	1.00
IGL02547:Akap6	APN	12	53140696	missense	probably damaging	1.00
IGL02588:Akap6	APN	12	52886499	nonsense	probably null
IGL02608:Akap6	APN	12	53010606	missense	probably benign	0.39
IGL02884:Akap6	APN	12	52886622	missense	probably benign	0.00
IGL02945:Akap6	APN	12	52880837	missense	probably damaging	1.00
IGL03029:Akap6	APN	12	52886412	missense	probably damaging	1.00
IGL03129:Akap6	APN	12	53140306	missense	probably damaging	1.00
R0133:Akap6	UTSW	12	53139471	nonsense	probably null
R0166:Akap6	UTSW	12	53140924	missense	probably benign	0.04
R0189:Akap6	UTSW	12	53141254	missense	probably benign	0.41
R0532:Akap6	UTSW	12	52887983	missense	probably benign	0.00
R0632:Akap6	UTSW	12	52937148	missense	probably damaging	1.00
R0666:Akap6	UTSW	12	52911808	missense	probably damaging	1.00
R0723:Akap6	UTSW	12	53141902	missense	probably damaging	1.00
R0763:Akap6	UTSW	12	53142214	missense	possibly damaging	0.93
R0785:Akap6	UTSW	12	52886622	missense	probably benign	0.00
R0879:Akap6	UTSW	12	52880799	missense	probably damaging	1.00
R0880:Akap6	UTSW	12	53139508	missense	possibly damaging	0.93
R1033:Akap6	UTSW	12	53069222	missense	probably damaging	0.97
R1055:Akap6	UTSW	12	52880672	nonsense	probably null
R1199:Akap6	UTSW	12	52796190	missense	probably damaging	1.00
R1295:Akap6	UTSW	12	52887029	missense	probably damaging	1.00
R1389:Akap6	UTSW	12	53139520	missense	probably benign	0.15
R1471:Akap6	UTSW	12	53141496	missense	probably benign	0.05
R1483:Akap6	UTSW	12	52796087	missense	probably damaging	1.00
R1512:Akap6	UTSW	12	52937154	missense	probably damaging	1.00
R1648:Akap6	UTSW	12	53142006	nonsense	probably null
R1791:Akap6	UTSW	12	53069125	missense	probably damaging	1.00
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1888:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1891:Akap6	UTSW	12	53142175	missense	possibly damaging	0.88
R1899:Akap6	UTSW	12	53141852	missense	possibly damaging	0.95
R1917:Akap6	UTSW	12	53104612	missense	probably benign	0.13
R1970:Akap6	UTSW	12	52938475	missense	probably damaging	0.96
R1987:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R1988:Akap6	UTSW	12	53140795	missense	possibly damaging	0.78
R2153:Akap6	UTSW	12	53141404	missense	probably benign	0.03
R2567:Akap6	UTSW	12	52938373	missense	probably damaging	1.00
R2568:Akap6	UTSW	12	52887278	missense	possibly damaging	0.77
R3025:Akap6	UTSW	12	53140143	missense	probably benign
R3051:Akap6	UTSW	12	52887033	missense	probably damaging	1.00
R3195:Akap6	UTSW	12	53072457	nonsense	probably null
R3196:Akap6	UTSW	12	53072457	nonsense	probably null
R3426:Akap6	UTSW	12	52888034	missense	probably damaging	1.00
R3783:Akap6	UTSW	12	52880769	missense	probably damaging	1.00
R3934:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3936:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92
R3967:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R3970:Akap6	UTSW	12	53141453	missense	probably damaging	1.00
R4042:Akap6	UTSW	12	53139379	critical splice acceptor site	probably null
R4095:Akap6	UTSW	12	53139462	missense	probably damaging	1.00
R4152:Akap6	UTSW	12	53140407	missense	probably benign	0.45
R4231:Akap6	UTSW	12	53141038	missense	probably damaging	1.00
R4232:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4233:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4234:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4236:Akap6	UTSW	12	53139671	missense	probably damaging	1.00
R4475:Akap6	UTSW	12	53141643	missense	probably benign	0.00
R4513:Akap6	UTSW	12	52796004	missense	probably benign	0.03
R4686:Akap6	UTSW	12	52887623	frame shift	probably null
R4724:Akap6	UTSW	12	52795885	missense	possibly damaging	0.80
R4782:Akap6	UTSW	12	52887623	frame shift	probably null
R4852:Akap6	UTSW	12	53104675	missense	probably damaging	1.00
R5024:Akap6	UTSW	12	53142562	missense	probably benign	0.01
R5116:Akap6	UTSW	12	53141515	missense	probably benign	0.01
R5164:Akap6	UTSW	12	53142466	missense	probably benign
R5225:Akap6	UTSW	12	52886546	missense	probably damaging	1.00
R5269:Akap6	UTSW	12	53139843	missense	probably damaging	0.99
R5352:Akap6	UTSW	12	52796097	missense	probably damaging	1.00
R5496:Akap6	UTSW	12	53140653	missense	possibly damaging	0.87
R5551:Akap6	UTSW	12	52795964	missense	probably damaging	1.00
R5997:Akap6	UTSW	12	52937233	critical splice donor site	probably null
R6137:Akap6	UTSW	12	53140354	missense	probably damaging	1.00
R6151:Akap6	UTSW	12	53025792	missense	probably damaging	1.00
R6169:Akap6	UTSW	12	53142358	missense	probably benign
R6307:Akap6	UTSW	12	53141568	missense	possibly damaging	0.85
R6351:Akap6	UTSW	12	53142025	missense	probably damaging	0.98
R6479:Akap6	UTSW	12	53141169	missense	probably damaging	1.00
R6502:Akap6	UTSW	12	53140215	missense	probably damaging	1.00
R6760:Akap6	UTSW	12	53139778	missense	probably damaging	1.00
R6778:Akap6	UTSW	12	53025816	missense	probably damaging	1.00
R6837:Akap6	UTSW	12	53141262	missense	probably damaging	1.00
R6896:Akap6	UTSW	12	52887494	missense	probably benign	0.06
R6917:Akap6	UTSW	12	53069168	missense	probably null	0.97
R6983:Akap6	UTSW	12	52887653	missense	probably damaging	1.00
R7142:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7143:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7216:Akap6	UTSW	12	53140457	missense	probably benign	0.02
R7297:Akap6	UTSW	12	52887364	missense	probably benign	0.02
R7356:Akap6	UTSW	12	52911864	missense	probably damaging	1.00
R7378:Akap6	UTSW	12	53142574	missense	probably benign	0.00
R7382:Akap6	UTSW	12	53142171	missense	probably benign	0.00
R7498:Akap6	UTSW	12	53142705	nonsense	probably null
R7542:Akap6	UTSW	12	53069234	missense	probably damaging	1.00
R7589:Akap6	UTSW	12	53142063	nonsense	probably null
R7676:Akap6	UTSW	12	52886850	missense	possibly damaging	0.94
R7814:Akap6	UTSW	12	53140961	missense	probably benign	0.28
R7971:Akap6	UTSW	12	53139795	missense	probably damaging	1.00
R8039:Akap6	UTSW	12	53141676	missense	probably benign	0.00
R8425:Akap6	UTSW	12	52886621	missense	probably benign	0.00
R8747:Akap6	UTSW	12	53142216	missense	probably benign	0.01
R8885:Akap6	UTSW	12	53141536	missense	probably benign
R8956:Akap6	UTSW	12	53140344	missense	probably benign	0.00
R8989:Akap6	UTSW	12	52880871	missense	probably damaging	1.00
R9014:Akap6	UTSW	12	53139620	missense	possibly damaging	0.60
R9031:Akap6	UTSW	12	53142048	missense	probably benign	0.36
R9216:Akap6	UTSW	12	52880885	missense	probably benign	0.05
R9220:Akap6	UTSW	12	53140449	missense	possibly damaging	0.49
R9243:Akap6	UTSW	12	53141252	missense	probably benign	0.08
R9286:Akap6	UTSW	12	53072471	missense	possibly damaging	0.90
R9347:Akap6	UTSW	12	53069111	missense	probably damaging	1.00
R9475:Akap6	UTSW	12	53010552	missense	probably damaging	1.00
R9509:Akap6	UTSW	12	53142238	missense	probably damaging	0.99
R9523:Akap6	UTSW	12	52795889	missense	probably benign	0.02
R9600:Akap6	UTSW	12	52886558	missense	probably benign	0.04
R9612:Akap6	UTSW	12	52911907	missense	probably damaging	1.00
R9627:Akap6	UTSW	12	53104630	missense
R9666:Akap6	UTSW	12	53141535	missense	probably benign
R9784:Akap6	UTSW	12	53141070	missense	probably damaging	1.00
X0062:Akap6	UTSW	12	53142361	missense	probably benign	0.43
Z1176:Akap6	UTSW	12	53140444	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TGGAATGAGTGAGGATGCCC -3'
(R):5'- AGTAAGGCCTCACCAAGCTG -3'

Sequencing Primer
(F):5'- GTGCATGAAGAATCCAACGACCTTG -3'
(R):5'- TGGAACCCCCTAAAAGGTCTGG -3'

Posted On

2015-06-12