Incidental Mutation 'R4235:Hecw1'
ID 321083
Institutional Source Beutler Lab
Gene Symbol Hecw1
Ensembl Gene ENSMUSG00000021301
Gene Name HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Synonyms E130207I19Rik, NEDL1
MMRRC Submission 041052-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4235 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 14226438-14523228 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 14317139 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Proline at position 423 (A423P)
Ref Sequence ENSEMBL: ENSMUSP00000106145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110516] [ENSMUST00000220718]
AlphaFold Q8K4P8
Predicted Effect probably benign
Transcript: ENSMUST00000110516
AA Change: A423P

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106145
Gene: ENSMUSG00000021301
AA Change: A423P

DomainStartEndE-ValueType
Pfam:HECW_N 65 184 6.5e-62 PFAM
C2 206 317 1.02e-12 SMART
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 577 598 N/A INTRINSIC
low complexity region 677 704 N/A INTRINSIC
low complexity region 731 745 N/A INTRINSIC
WW 827 859 8.66e-13 SMART
coiled coil region 873 898 N/A INTRINSIC
low complexity region 917 930 N/A INTRINSIC
WW 1017 1049 5.59e-7 SMART
Blast:HECTc 1137 1192 3e-26 BLAST
low complexity region 1193 1208 N/A INTRINSIC
low complexity region 1212 1223 N/A INTRINSIC
HECTc 1267 1604 1.36e-185 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220718
AA Change: A10P

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223317
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
5730596B20Rik G T 6: 52,178,961 probably benign Het
9530053A07Rik T A 7: 28,156,648 D1953E probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Bnc2 A G 4: 84,293,514 V231A probably damaging Het
Bod1l A G 5: 41,821,455 S839P probably damaging Het
Casp8 T A 1: 58,833,698 H264Q possibly damaging Het
Cc2d1b A T 4: 108,625,352 probably benign Het
Cpne6 A T 14: 55,513,600 probably benign Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dgkd T A 1: 87,931,982 L774* probably null Het
Fbxl2 T A 9: 113,989,163 N205I probably benign Het
Fkbp15 A T 4: 62,336,456 I269K probably benign Het
Gm13023 G C 4: 143,794,774 C320S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Has1 G T 17: 17,850,036 R208S possibly damaging Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Ifi208 T G 1: 173,682,911 S211A probably benign Het
Ighv6-3 T C 12: 114,391,874 E65G probably damaging Het
Igkv9-120 A T 6: 68,050,333 D77V probably benign Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm2a A G 19: 4,322,521 I932T probably damaging Het
Krt17 T C 11: 100,257,868 T279A possibly damaging Het
Lamp1 T C 8: 13,167,192 V67A possibly damaging Het
Limk1 T C 5: 134,670,478 I142V probably benign Het
Mamdc2 T C 19: 23,374,017 N182D possibly damaging Het
Mcpt1 G A 14: 56,018,560 probably null Het
Med12l T G 3: 59,257,223 probably null Het
Mfsd10 G T 5: 34,635,625 T44N probably damaging Het
Mrps27 T C 13: 99,405,041 S218P probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Neil2 A C 14: 63,191,841 M1R probably null Het
Nelfcd T C 2: 174,427,048 F587L probably damaging Het
Nfil3 T C 13: 52,968,799 D23G probably benign Het
Nit2 T C 16: 57,157,160 K169R probably benign Het
Nxt1 T C 2: 148,675,347 S3P probably benign Het
Ogt A G X: 101,667,525 N434D probably damaging Het
Olfr679 T A 7: 105,085,787 S24T possibly damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rsl1 T C 13: 67,177,162 probably null Het
Sobp G A 10: 43,022,900 H230Y probably damaging Het
Sptan1 A G 2: 30,026,588 E2096G probably damaging Het
Tie1 G T 4: 118,478,405 S797* probably null Het
Tmem266 T C 9: 55,418,107 I186T probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tnfaip6 T C 2: 52,050,864 F139S probably damaging Het
Tnrc6a T C 7: 123,171,680 S898P probably benign Het
Trim24 A G 6: 37,964,740 D911G probably damaging Het
Tyw5 T C 1: 57,388,488 probably benign Het
Ubr3 C T 2: 70,016,385 Q1651* probably null Het
Unc13c T A 9: 73,530,952 I1943F possibly damaging Het
Usp47 T A 7: 112,110,048 S1334T probably damaging Het
Vmn1r215 T A 13: 23,075,931 V47E probably benign Het
Vmn1r224 T A 17: 20,419,362 M67K possibly damaging Het
Wdfy3 T A 5: 101,922,634 probably null Het
Zfc3h1 T C 10: 115,418,799 Y1433H probably benign Het
Other mutations in Hecw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Hecw1 APN 13 14265980 missense possibly damaging 0.71
IGL00813:Hecw1 APN 13 14278376 critical splice acceptor site probably null
IGL00843:Hecw1 APN 13 14247573 missense probably benign 0.02
IGL00942:Hecw1 APN 13 14340740 splice site probably benign
IGL00976:Hecw1 APN 13 14318972 missense probably damaging 1.00
IGL01289:Hecw1 APN 13 14264134 missense probably damaging 1.00
IGL01675:Hecw1 APN 13 14234422 missense probably damaging 1.00
IGL01783:Hecw1 APN 13 14278293 missense probably damaging 1.00
IGL01941:Hecw1 APN 13 14316310 missense probably benign 0.01
IGL02170:Hecw1 APN 13 14264158 missense possibly damaging 0.75
IGL02172:Hecw1 APN 13 14264149 missense probably damaging 1.00
IGL02214:Hecw1 APN 13 14300393 missense probably damaging 1.00
IGL02350:Hecw1 APN 13 14248338 splice site probably null
IGL02357:Hecw1 APN 13 14248338 splice site probably null
IGL02372:Hecw1 APN 13 14264121 missense probably damaging 1.00
IGL02591:Hecw1 APN 13 14357236 splice site probably benign
IGL02718:Hecw1 APN 13 14306935 critical splice acceptor site probably null
IGL02795:Hecw1 APN 13 14322517 missense probably damaging 1.00
IGL02941:Hecw1 APN 13 14377726 missense probably damaging 1.00
IGL03256:Hecw1 APN 13 14280484 missense probably damaging 0.99
IGL03256:Hecw1 APN 13 14280485 missense probably benign 0.36
IGL03366:Hecw1 APN 13 14377797 missense probably damaging 1.00
deflated UTSW 13 14247620 missense possibly damaging 0.69
Demoralized UTSW 13 14316818 nonsense probably null
Letdown UTSW 13 14316492 missense probably benign 0.40
BB001:Hecw1 UTSW 13 14322528 missense probably damaging 1.00
BB011:Hecw1 UTSW 13 14322528 missense probably damaging 1.00
IGL03014:Hecw1 UTSW 13 14245808 missense probably damaging 1.00
PIT4378001:Hecw1 UTSW 13 14377783 missense probably damaging 0.98
R0555:Hecw1 UTSW 13 14236941 missense probably damaging 1.00
R0617:Hecw1 UTSW 13 14280442 missense probably benign 0.44
R1476:Hecw1 UTSW 13 14306086 missense probably damaging 1.00
R1479:Hecw1 UTSW 13 14316492 missense probably benign 0.40
R1551:Hecw1 UTSW 13 14316943 missense probably damaging 1.00
R1579:Hecw1 UTSW 13 14377907 missense probably damaging 1.00
R1584:Hecw1 UTSW 13 14340743 critical splice donor site probably null
R1735:Hecw1 UTSW 13 14377765 missense probably null 0.09
R1872:Hecw1 UTSW 13 14280449 nonsense probably null
R1897:Hecw1 UTSW 13 14377940 missense probably damaging 1.00
R2054:Hecw1 UTSW 13 14297413 missense probably damaging 0.97
R2085:Hecw1 UTSW 13 14264087 missense possibly damaging 0.93
R2134:Hecw1 UTSW 13 14377700 missense probably damaging 1.00
R2172:Hecw1 UTSW 13 14377706 missense probably damaging 1.00
R2258:Hecw1 UTSW 13 14316138 missense probably benign 0.01
R2274:Hecw1 UTSW 13 14346068 missense probably benign 0.00
R2275:Hecw1 UTSW 13 14346068 missense probably benign 0.00
R2937:Hecw1 UTSW 13 14245836 missense possibly damaging 0.93
R3830:Hecw1 UTSW 13 14346058 missense probably benign 0.13
R3971:Hecw1 UTSW 13 14236929 missense probably damaging 1.00
R4065:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4066:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4366:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4382:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4385:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4510:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4511:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4558:Hecw1 UTSW 13 14247605 missense probably damaging 0.99
R4804:Hecw1 UTSW 13 14305985 missense probably benign 0.00
R4854:Hecw1 UTSW 13 14316892 missense probably benign 0.00
R5104:Hecw1 UTSW 13 14340792 missense probably damaging 1.00
R5113:Hecw1 UTSW 13 14346029 missense possibly damaging 0.94
R5167:Hecw1 UTSW 13 14285657 missense probably damaging 1.00
R5392:Hecw1 UTSW 13 14245762 missense probably damaging 1.00
R5394:Hecw1 UTSW 13 14322589 missense probably damaging 1.00
R5504:Hecw1 UTSW 13 14340902 missense probably benign 0.04
R5764:Hecw1 UTSW 13 14322509 missense probably damaging 1.00
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6228:Hecw1 UTSW 13 14346038 missense probably damaging 1.00
R6247:Hecw1 UTSW 13 14234425 nonsense probably null
R6252:Hecw1 UTSW 13 14272079 missense probably damaging 0.98
R6291:Hecw1 UTSW 13 14523007 unclassified probably benign
R6321:Hecw1 UTSW 13 14522829 missense probably benign 0.00
R6325:Hecw1 UTSW 13 14316446 missense probably damaging 1.00
R6328:Hecw1 UTSW 13 14247620 missense possibly damaging 0.69
R6557:Hecw1 UTSW 13 14316646 missense possibly damaging 0.78
R6566:Hecw1 UTSW 13 14297283 missense probably damaging 1.00
R6597:Hecw1 UTSW 13 14316818 nonsense probably null
R6821:Hecw1 UTSW 13 14264134 missense probably damaging 1.00
R6914:Hecw1 UTSW 13 14316838 missense probably damaging 0.99
R7078:Hecw1 UTSW 13 14434459 start codon destroyed probably null 0.21
R7114:Hecw1 UTSW 13 14311771 missense probably benign 0.02
R7140:Hecw1 UTSW 13 14316533 missense probably benign
R7150:Hecw1 UTSW 13 14434460 start codon destroyed probably benign
R7288:Hecw1 UTSW 13 14316236 missense probably benign 0.00
R7447:Hecw1 UTSW 13 14357204 missense probably damaging 1.00
R7479:Hecw1 UTSW 13 14340840 missense probably damaging 1.00
R7552:Hecw1 UTSW 13 14316250 missense probably damaging 0.99
R7590:Hecw1 UTSW 13 14264083 missense probably damaging 1.00
R7787:Hecw1 UTSW 13 14318909 missense probably damaging 1.00
R7803:Hecw1 UTSW 13 14234342 missense probably benign 0.25
R7924:Hecw1 UTSW 13 14322528 missense probably damaging 1.00
R7967:Hecw1 UTSW 13 14377747 missense probably damaging 1.00
R8176:Hecw1 UTSW 13 14247701 splice site probably null
R8195:Hecw1 UTSW 13 14306107 missense probably damaging 0.99
R8252:Hecw1 UTSW 13 14340840 missense probably damaging 1.00
R8696:Hecw1 UTSW 13 14357158 missense possibly damaging 0.93
R8827:Hecw1 UTSW 13 14264135 missense probably damaging 1.00
R8867:Hecw1 UTSW 13 14247690 critical splice acceptor site probably null
R8914:Hecw1 UTSW 13 14247603 missense probably damaging 1.00
R8942:Hecw1 UTSW 13 14306810 missense probably benign 0.28
R9126:Hecw1 UTSW 13 14372023 missense probably damaging 1.00
R9185:Hecw1 UTSW 13 14317043 missense probably damaging 0.99
R9203:Hecw1 UTSW 13 14316658 missense probably benign 0.00
R9236:Hecw1 UTSW 13 14316058 missense possibly damaging 0.61
R9291:Hecw1 UTSW 13 14316937 missense probably benign
R9312:Hecw1 UTSW 13 14371982 missense probably damaging 0.99
R9438:Hecw1 UTSW 13 14306829 missense probably benign 0.00
RF001:Hecw1 UTSW 13 14297424 missense probably damaging 1.00
X0020:Hecw1 UTSW 13 14230723 missense possibly damaging 0.52
X0066:Hecw1 UTSW 13 14280460 missense probably benign 0.13
Z1176:Hecw1 UTSW 13 14300333 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AGAGCTGTATTCTCTTCTGGCAAC -3'
(R):5'- TGCCCACAGATGATGAAGAGATC -3'

Sequencing Primer
(F):5'- CAACAGCGAGGATGGCGAATC -3'
(R):5'- AGATCTCTCTGAGTGCTGAGCC -3'
Posted On 2015-06-12