Mutagenetix > Incidental Mutations

Incidental Mutation 'R4235:Hecw1'

321083

Institutional Source

Beutler Lab

Gene Symbol

Hecw1

Ensembl Gene

ENSMUSG00000021301

Gene Name

HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1

Synonyms

E130207I19Rik, NEDL1

MMRRC Submission

041052-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4235 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14226438-14523228 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 14317139 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Proline at position 423 (A423P)

Ref Sequence

ENSEMBL: ENSMUSP00000106145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110516] [ENSMUST00000220718]

AlphaFold

Q8K4P8

Predicted Effect

probably benign
Transcript: ENSMUST00000110516
AA Change: A423P

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000106145
Gene: ENSMUSG00000021301
AA Change: A423P

Domain	Start	End	E-Value	Type
Pfam:HECW_N	65	184	6.5e-62	PFAM
C2	206	317	1.02e-12	SMART
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	512	N/A	INTRINSIC
low complexity region	577	598	N/A	INTRINSIC
low complexity region	677	704	N/A	INTRINSIC
low complexity region	731	745	N/A	INTRINSIC
WW	827	859	8.66e-13	SMART
coiled coil region	873	898	N/A	INTRINSIC
low complexity region	917	930	N/A	INTRINSIC
WW	1017	1049	5.59e-7	SMART
Blast:HECTc	1137	1192	3e-26	BLAST
low complexity region	1193	1208	N/A	INTRINSIC
low complexity region	1212	1223	N/A	INTRINSIC
HECTc	1267	1604	1.36e-185	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220718
AA Change: A10P

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221863

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222241

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223317

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

97% (68/70)

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	C	T	X: 70,394,529	A53T	probably benign	Het
5730596B20Rik	G	T	6: 52,178,961		probably benign	Het
9530053A07Rik	T	A	7: 28,156,648	D1953E	probably damaging	Het
Akap6	T	A	12: 53,139,671	N1289K	probably damaging	Het
Arhgap21	A	G	2: 20,887,137	V161A	probably damaging	Het
Arhgef18	T	C	8: 3,450,317	I541T	possibly damaging	Het
Atp7b	A	G	8: 22,011,023	Y955H	possibly damaging	Het
Bnc2	A	G	4: 84,293,514	V231A	probably damaging	Het
Bod1l	A	G	5: 41,821,455	S839P	probably damaging	Het
Casp8	T	A	1: 58,833,698	H264Q	possibly damaging	Het
Cc2d1b	A	T	4: 108,625,352		probably benign	Het
Cpne6	A	T	14: 55,513,600		probably benign	Het
Ddx1	C	T	12: 13,223,857	V590I	possibly damaging	Het
Dgkd	T	A	1: 87,931,982	L774*	probably null	Het
Fbxl2	T	A	9: 113,989,163	N205I	probably benign	Het
Fkbp15	A	T	4: 62,336,456	I269K	probably benign	Het
Gm13023	G	C	4: 143,794,774	C320S	probably damaging	Het
Gm26678	T	C	3: 54,633,083		noncoding transcript	Het
Has1	G	T	17: 17,850,036	R208S	possibly damaging	Het
Hspa12b	T	C	2: 131,139,012	V162A	probably benign	Het
Ifi208	T	G	1: 173,682,911	S211A	probably benign	Het
Ighv6-3	T	C	12: 114,391,874	E65G	probably damaging	Het
Igkv9-120	A	T	6: 68,050,333	D77V	probably benign	Het
Impg1	A	G	9: 80,345,329	L523P	probably damaging	Het
Ip6k2	G	A	9: 108,805,648	R319Q	probably benign	Het
Kdm2a	A	G	19: 4,322,521	I932T	probably damaging	Het
Krt17	T	C	11: 100,257,868	T279A	possibly damaging	Het
Lamp1	T	C	8: 13,167,192	V67A	possibly damaging	Het
Limk1	T	C	5: 134,670,478	I142V	probably benign	Het
Mamdc2	T	C	19: 23,374,017	N182D	possibly damaging	Het
Mcpt1	G	A	14: 56,018,560		probably null	Het
Med12l	T	G	3: 59,257,223		probably null	Het
Mfsd10	G	T	5: 34,635,625	T44N	probably damaging	Het
Mrps27	T	C	13: 99,405,041	S218P	probably damaging	Het
Mrps30	T	C	13: 118,386,840	D132G	probably damaging	Het
Neil2	A	C	14: 63,191,841	M1R	probably null	Het
Nelfcd	T	C	2: 174,427,048	F587L	probably damaging	Het
Nfil3	T	C	13: 52,968,799	D23G	probably benign	Het
Nit2	T	C	16: 57,157,160	K169R	probably benign	Het
Nxt1	T	C	2: 148,675,347	S3P	probably benign	Het
Ogt	A	G	X: 101,667,525	N434D	probably damaging	Het
Olfr679	T	A	7: 105,085,787	S24T	possibly damaging	Het
Pcdhga5	A	G	18: 37,695,948	D483G	possibly damaging	Het
Ralgapa1	C	T	12: 55,640,644	R2019Q	probably damaging	Het
Rsl1	T	C	13: 67,177,162		probably null	Het
Sobp	G	A	10: 43,022,900	H230Y	probably damaging	Het
Sptan1	A	G	2: 30,026,588	E2096G	probably damaging	Het
Tie1	G	T	4: 118,478,405	S797*	probably null	Het
Tmem266	T	C	9: 55,418,107	I186T	probably damaging	Het
Tmem38b	T	C	4: 53,840,710	C66R	probably damaging	Het
Tnfaip6	T	C	2: 52,050,864	F139S	probably damaging	Het
Tnrc6a	T	C	7: 123,171,680	S898P	probably benign	Het
Trim24	A	G	6: 37,964,740	D911G	probably damaging	Het
Tyw5	T	C	1: 57,388,488		probably benign	Het
Ubr3	C	T	2: 70,016,385	Q1651*	probably null	Het
Unc13c	T	A	9: 73,530,952	I1943F	possibly damaging	Het
Usp47	T	A	7: 112,110,048	S1334T	probably damaging	Het
Vmn1r215	T	A	13: 23,075,931	V47E	probably benign	Het
Vmn1r224	T	A	17: 20,419,362	M67K	possibly damaging	Het
Wdfy3	T	A	5: 101,922,634		probably null	Het
Zfc3h1	T	C	10: 115,418,799	Y1433H	probably benign	Het

Other mutations in Hecw1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00591:Hecw1	APN	13	14265980	missense	possibly damaging	0.71
IGL00813:Hecw1	APN	13	14278376	critical splice acceptor site	probably null
IGL00843:Hecw1	APN	13	14247573	missense	probably benign	0.02
IGL00942:Hecw1	APN	13	14340740	splice site	probably benign
IGL00976:Hecw1	APN	13	14318972	missense	probably damaging	1.00
IGL01289:Hecw1	APN	13	14264134	missense	probably damaging	1.00
IGL01675:Hecw1	APN	13	14234422	missense	probably damaging	1.00
IGL01783:Hecw1	APN	13	14278293	missense	probably damaging	1.00
IGL01941:Hecw1	APN	13	14316310	missense	probably benign	0.01
IGL02170:Hecw1	APN	13	14264158	missense	possibly damaging	0.75
IGL02172:Hecw1	APN	13	14264149	missense	probably damaging	1.00
IGL02214:Hecw1	APN	13	14300393	missense	probably damaging	1.00
IGL02350:Hecw1	APN	13	14248338	splice site	probably null
IGL02357:Hecw1	APN	13	14248338	splice site	probably null
IGL02372:Hecw1	APN	13	14264121	missense	probably damaging	1.00
IGL02591:Hecw1	APN	13	14357236	splice site	probably benign
IGL02718:Hecw1	APN	13	14306935	critical splice acceptor site	probably null
IGL02795:Hecw1	APN	13	14322517	missense	probably damaging	1.00
IGL02941:Hecw1	APN	13	14377726	missense	probably damaging	1.00
IGL03256:Hecw1	APN	13	14280484	missense	probably damaging	0.99
IGL03256:Hecw1	APN	13	14280485	missense	probably benign	0.36
IGL03366:Hecw1	APN	13	14377797	missense	probably damaging	1.00
deflated	UTSW	13	14247620	missense	possibly damaging	0.69
Demoralized	UTSW	13	14316818	nonsense	probably null
Letdown	UTSW	13	14316492	missense	probably benign	0.40
BB001:Hecw1	UTSW	13	14322528	missense	probably damaging	1.00
BB011:Hecw1	UTSW	13	14322528	missense	probably damaging	1.00
IGL03014:Hecw1	UTSW	13	14245808	missense	probably damaging	1.00
PIT4378001:Hecw1	UTSW	13	14377783	missense	probably damaging	0.98
R0555:Hecw1	UTSW	13	14236941	missense	probably damaging	1.00
R0617:Hecw1	UTSW	13	14280442	missense	probably benign	0.44
R1476:Hecw1	UTSW	13	14306086	missense	probably damaging	1.00
R1479:Hecw1	UTSW	13	14316492	missense	probably benign	0.40
R1551:Hecw1	UTSW	13	14316943	missense	probably damaging	1.00
R1579:Hecw1	UTSW	13	14377907	missense	probably damaging	1.00
R1584:Hecw1	UTSW	13	14340743	critical splice donor site	probably null
R1735:Hecw1	UTSW	13	14377765	missense	probably null	0.09
R1872:Hecw1	UTSW	13	14280449	nonsense	probably null
R1897:Hecw1	UTSW	13	14377940	missense	probably damaging	1.00
R2054:Hecw1	UTSW	13	14297413	missense	probably damaging	0.97
R2085:Hecw1	UTSW	13	14264087	missense	possibly damaging	0.93
R2134:Hecw1	UTSW	13	14377700	missense	probably damaging	1.00
R2172:Hecw1	UTSW	13	14377706	missense	probably damaging	1.00
R2258:Hecw1	UTSW	13	14316138	missense	probably benign	0.01
R2274:Hecw1	UTSW	13	14346068	missense	probably benign	0.00
R2275:Hecw1	UTSW	13	14346068	missense	probably benign	0.00
R2937:Hecw1	UTSW	13	14245836	missense	possibly damaging	0.93
R3830:Hecw1	UTSW	13	14346058	missense	probably benign	0.13
R3971:Hecw1	UTSW	13	14236929	missense	probably damaging	1.00
R4065:Hecw1	UTSW	13	14316431	missense	probably damaging	1.00
R4066:Hecw1	UTSW	13	14316431	missense	probably damaging	1.00
R4366:Hecw1	UTSW	13	14316164	missense	probably damaging	1.00
R4382:Hecw1	UTSW	13	14316164	missense	probably damaging	1.00
R4385:Hecw1	UTSW	13	14316164	missense	probably damaging	1.00
R4510:Hecw1	UTSW	13	14357191	missense	probably damaging	1.00
R4511:Hecw1	UTSW	13	14357191	missense	probably damaging	1.00
R4558:Hecw1	UTSW	13	14247605	missense	probably damaging	0.99
R4804:Hecw1	UTSW	13	14305985	missense	probably benign	0.00
R4854:Hecw1	UTSW	13	14316892	missense	probably benign	0.00
R5104:Hecw1	UTSW	13	14340792	missense	probably damaging	1.00
R5113:Hecw1	UTSW	13	14346029	missense	possibly damaging	0.94
R5167:Hecw1	UTSW	13	14285657	missense	probably damaging	1.00
R5392:Hecw1	UTSW	13	14245762	missense	probably damaging	1.00
R5394:Hecw1	UTSW	13	14322589	missense	probably damaging	1.00
R5504:Hecw1	UTSW	13	14340902	missense	probably benign	0.04
R5764:Hecw1	UTSW	13	14322509	missense	probably damaging	1.00
R6038:Hecw1	UTSW	13	14346062	missense	probably benign	0.28
R6038:Hecw1	UTSW	13	14346062	missense	probably benign	0.28
R6228:Hecw1	UTSW	13	14346038	missense	probably damaging	1.00
R6247:Hecw1	UTSW	13	14234425	nonsense	probably null
R6252:Hecw1	UTSW	13	14272079	missense	probably damaging	0.98
R6291:Hecw1	UTSW	13	14523007	unclassified	probably benign
R6321:Hecw1	UTSW	13	14522829	missense	probably benign	0.00
R6325:Hecw1	UTSW	13	14316446	missense	probably damaging	1.00
R6328:Hecw1	UTSW	13	14247620	missense	possibly damaging	0.69
R6557:Hecw1	UTSW	13	14316646	missense	possibly damaging	0.78
R6566:Hecw1	UTSW	13	14297283	missense	probably damaging	1.00
R6597:Hecw1	UTSW	13	14316818	nonsense	probably null
R6821:Hecw1	UTSW	13	14264134	missense	probably damaging	1.00
R6914:Hecw1	UTSW	13	14316838	missense	probably damaging	0.99
R7078:Hecw1	UTSW	13	14434459	start codon destroyed	probably null	0.21
R7114:Hecw1	UTSW	13	14311771	missense	probably benign	0.02
R7140:Hecw1	UTSW	13	14316533	missense	probably benign
R7150:Hecw1	UTSW	13	14434460	start codon destroyed	probably benign
R7288:Hecw1	UTSW	13	14316236	missense	probably benign	0.00
R7447:Hecw1	UTSW	13	14357204	missense	probably damaging	1.00
R7479:Hecw1	UTSW	13	14340840	missense	probably damaging	1.00
R7552:Hecw1	UTSW	13	14316250	missense	probably damaging	0.99
R7590:Hecw1	UTSW	13	14264083	missense	probably damaging	1.00
R7787:Hecw1	UTSW	13	14318909	missense	probably damaging	1.00
R7803:Hecw1	UTSW	13	14234342	missense	probably benign	0.25
R7924:Hecw1	UTSW	13	14322528	missense	probably damaging	1.00
R7967:Hecw1	UTSW	13	14377747	missense	probably damaging	1.00
R8176:Hecw1	UTSW	13	14247701	splice site	probably null
R8195:Hecw1	UTSW	13	14306107	missense	probably damaging	0.99
R8252:Hecw1	UTSW	13	14340840	missense	probably damaging	1.00
R8696:Hecw1	UTSW	13	14357158	missense	possibly damaging	0.93
R8827:Hecw1	UTSW	13	14264135	missense	probably damaging	1.00
R8867:Hecw1	UTSW	13	14247690	critical splice acceptor site	probably null
R8914:Hecw1	UTSW	13	14247603	missense	probably damaging	1.00
R8942:Hecw1	UTSW	13	14306810	missense	probably benign	0.28
R9126:Hecw1	UTSW	13	14372023	missense	probably damaging	1.00
R9185:Hecw1	UTSW	13	14317043	missense	probably damaging	0.99
R9203:Hecw1	UTSW	13	14316658	missense	probably benign	0.00
R9236:Hecw1	UTSW	13	14316058	missense	possibly damaging	0.61
R9291:Hecw1	UTSW	13	14316937	missense	probably benign
R9312:Hecw1	UTSW	13	14371982	missense	probably damaging	0.99
R9438:Hecw1	UTSW	13	14306829	missense	probably benign	0.00
RF001:Hecw1	UTSW	13	14297424	missense	probably damaging	1.00
X0020:Hecw1	UTSW	13	14230723	missense	possibly damaging	0.52
X0066:Hecw1	UTSW	13	14280460	missense	probably benign	0.13
Z1176:Hecw1	UTSW	13	14300333	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- AGAGCTGTATTCTCTTCTGGCAAC -3'
(R):5'- TGCCCACAGATGATGAAGAGATC -3'

Sequencing Primer
(F):5'- CAACAGCGAGGATGGCGAATC -3'
(R):5'- AGATCTCTCTGAGTGCTGAGCC -3'

Posted On

2015-06-12