Incidental Mutation 'R4235:Pcdhga5'
ID321096
Institutional Source Beutler Lab
Gene Symbol Pcdhga5
Ensembl Gene ENSMUSG00000103567
Gene Nameprotocadherin gamma subfamily A, 5
Synonyms
MMRRC Submission 041052-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R4235 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37694380-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37695948 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 483 (D483G)
Ref Sequence ENSEMBL: ENSMUSP00000141893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073447] [ENSMUST00000115661] [ENSMUST00000192931] [ENSMUST00000193414] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000195112]
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000193414
AA Change: D483G

PolyPhen 2 Score 0.535 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567
AA Change: D483G

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193631
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Meta Mutation Damage Score 0.1166 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
5730596B20Rik G T 6: 52,178,961 probably benign Het
9530053A07Rik T A 7: 28,156,648 D1953E probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Bnc2 A G 4: 84,293,514 V231A probably damaging Het
Bod1l A G 5: 41,821,455 S839P probably damaging Het
Casp8 T A 1: 58,833,698 H264Q possibly damaging Het
Cc2d1b A T 4: 108,625,352 probably benign Het
Cpne6 A T 14: 55,513,600 probably benign Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dgkd T A 1: 87,931,982 L774* probably null Het
Fbxl2 T A 9: 113,989,163 N205I probably benign Het
Fkbp15 A T 4: 62,336,456 I269K probably benign Het
Gm13023 G C 4: 143,794,774 C320S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Has1 G T 17: 17,850,036 R208S possibly damaging Het
Hecw1 C G 13: 14,317,139 A423P probably benign Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Ifi208 T G 1: 173,682,911 S211A probably benign Het
Ighv6-3 T C 12: 114,391,874 E65G probably damaging Het
Igkv9-120 A T 6: 68,050,333 D77V probably benign Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm2a A G 19: 4,322,521 I932T probably damaging Het
Krt17 T C 11: 100,257,868 T279A possibly damaging Het
Lamp1 T C 8: 13,167,192 V67A possibly damaging Het
Limk1 T C 5: 134,670,478 I142V probably benign Het
Mamdc2 T C 19: 23,374,017 N182D possibly damaging Het
Mcpt1 G A 14: 56,018,560 probably null Het
Med12l T G 3: 59,257,223 probably null Het
Mfsd10 G T 5: 34,635,625 T44N probably damaging Het
Mrps27 T C 13: 99,405,041 S218P probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Neil2 A C 14: 63,191,841 M1R probably null Het
Nelfcd T C 2: 174,427,048 F587L probably damaging Het
Nfil3 T C 13: 52,968,799 D23G probably benign Het
Nit2 T C 16: 57,157,160 K169R probably benign Het
Nxt1 T C 2: 148,675,347 S3P probably benign Het
Ogt A G X: 101,667,525 N434D probably damaging Het
Olfr679 T A 7: 105,085,787 S24T possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rsl1 T C 13: 67,177,162 probably null Het
Sobp G A 10: 43,022,900 H230Y probably damaging Het
Sptan1 A G 2: 30,026,588 E2096G probably damaging Het
Tie1 G T 4: 118,478,405 S797* probably null Het
Tmem266 T C 9: 55,418,107 I186T probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tnfaip6 T C 2: 52,050,864 F139S probably damaging Het
Tnrc6a T C 7: 123,171,680 S898P probably benign Het
Trim24 A G 6: 37,964,740 D911G probably damaging Het
Tyw5 T C 1: 57,388,488 probably benign Het
Ubr3 C T 2: 70,016,385 Q1651* probably null Het
Unc13c T A 9: 73,530,952 I1943F possibly damaging Het
Usp47 T A 7: 112,110,048 S1334T probably damaging Het
Vmn1r215 T A 13: 23,075,931 V47E probably benign Het
Vmn1r224 T A 17: 20,419,362 M67K possibly damaging Het
Wdfy3 T A 5: 101,922,634 probably null Het
Zfc3h1 T C 10: 115,418,799 Y1433H probably benign Het
Other mutations in Pcdhga5
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4581001:Pcdhga5 UTSW 18 37696857 missense probably benign 0.01
R3775:Pcdhga5 UTSW 18 37695114 missense possibly damaging 0.89
R4232:Pcdhga5 UTSW 18 37695948 missense possibly damaging 0.54
R4234:Pcdhga5 UTSW 18 37695948 missense possibly damaging 0.54
R4815:Pcdhga5 UTSW 18 37695194 missense probably damaging 0.99
R4884:Pcdhga5 UTSW 18 37694627 missense probably damaging 0.99
R5159:Pcdhga5 UTSW 18 37695666 missense probably benign 0.24
R5279:Pcdhga5 UTSW 18 37694721 missense probably benign 0.12
R5393:Pcdhga5 UTSW 18 37696667 missense probably benign 0.25
R6271:Pcdhga5 UTSW 18 37696682 missense probably benign 0.01
R6574:Pcdhga5 UTSW 18 37695381 missense probably damaging 1.00
R7727:Pcdhga5 UTSW 18 37695045 missense probably benign 0.41
R7747:Pcdhga5 UTSW 18 37696782 missense possibly damaging 0.69
R7775:Pcdhga5 UTSW 18 37695525 missense probably damaging 1.00
R7778:Pcdhga5 UTSW 18 37695525 missense probably damaging 1.00
R7819:Pcdhga5 UTSW 18 37696580 missense probably damaging 1.00
Z1177:Pcdhga5 UTSW 18 37695534 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTGTTGACCGTGGAACTC -3'
(R):5'- TCATTCTGGTCCAGCACAAAC -3'

Sequencing Primer
(F):5'- GTTGACCGTGGAACTCCTCCC -3'
(R):5'- AGCTCATGGACACATTGCTG -3'
Posted On2015-06-12