Incidental Mutation 'R4235:Kdm2a'
ID321097
Institutional Source Beutler Lab
Gene Symbol Kdm2a
Ensembl Gene ENSMUSG00000054611
Gene Namelysine (K)-specific demethylase 2A
SynonymsGm4560, lalina, Fbl7, Jhdm1a, Cxxc8, Fbxl11, 5530401A10Rik
MMRRC Submission 041052-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R4235 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4314419-4398285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4322521 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 932 (I932T)
Ref Sequence ENSEMBL: ENSMUSP00000076698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047898] [ENSMUST00000075856] [ENSMUST00000176653]
Predicted Effect probably damaging
Transcript: ENSMUST00000047898
AA Change: I932T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047683
Gene: ENSMUSG00000054611
AA Change: I932T

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
JmjC 148 316 1.52e-34 SMART
low complexity region 416 433 N/A INTRINSIC
PDB:2YU2|A 440 517 1e-35 PDB
Pfam:zf-CXXC 563 609 7.5e-16 PFAM
PHD 619 676 3.25e-4 SMART
low complexity region 848 875 N/A INTRINSIC
FBOX 892 932 1.58e-2 SMART
low complexity region 987 998 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075856
AA Change: I932T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076698
Gene: ENSMUSG00000054611
AA Change: I932T

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
JmjC 148 316 1.52e-34 SMART
low complexity region 416 433 N/A INTRINSIC
PDB:2YU2|A 440 517 1e-35 PDB
Pfam:zf-CXXC 563 609 7.5e-16 PFAM
PHD 619 676 3.25e-4 SMART
low complexity region 848 875 N/A INTRINSIC
FBOX 892 932 1.58e-2 SMART
low complexity region 987 998 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175978
Predicted Effect unknown
Transcript: ENSMUST00000176532
AA Change: I9T
Predicted Effect probably benign
Transcript: ENSMUST00000176653
SMART Domains Protein: ENSMUSP00000135745
Gene: ENSMUSG00000054611

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
PDB:2YU2|A 52 77 4e-7 PDB
Pfam:zf-CXXC 123 169 3e-16 PFAM
PHD 179 236 3.25e-4 SMART
Meta Mutation Damage Score 0.8196 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains at least six highly degenerated leucine-rich repeats. This family member plays a role in epigenetic silencing. It nucleates at CpG islands and specifically demethylates both mono- and di-methylated lysine-36 of histone H3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show embryonic lethality, severe growth retardation, reduced neuron proliferation, increased neuron apoptosis, impaired neuron differentiation, small hearts, abnormal cardiac looping and, in some cases, incomplete embryonic turning and neural tube closure defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
5730596B20Rik G T 6: 52,178,961 probably benign Het
9530053A07Rik T A 7: 28,156,648 D1953E probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Bnc2 A G 4: 84,293,514 V231A probably damaging Het
Bod1l A G 5: 41,821,455 S839P probably damaging Het
Casp8 T A 1: 58,833,698 H264Q possibly damaging Het
Cc2d1b A T 4: 108,625,352 probably benign Het
Cpne6 A T 14: 55,513,600 probably benign Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dgkd T A 1: 87,931,982 L774* probably null Het
Fbxl2 T A 9: 113,989,163 N205I probably benign Het
Fkbp15 A T 4: 62,336,456 I269K probably benign Het
Gm13023 G C 4: 143,794,774 C320S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Has1 G T 17: 17,850,036 R208S possibly damaging Het
Hecw1 C G 13: 14,317,139 A423P probably benign Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Ifi208 T G 1: 173,682,911 S211A probably benign Het
Ighv6-3 T C 12: 114,391,874 E65G probably damaging Het
Igkv9-120 A T 6: 68,050,333 D77V probably benign Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Krt17 T C 11: 100,257,868 T279A possibly damaging Het
Lamp1 T C 8: 13,167,192 V67A possibly damaging Het
Limk1 T C 5: 134,670,478 I142V probably benign Het
Mamdc2 T C 19: 23,374,017 N182D possibly damaging Het
Mcpt1 G A 14: 56,018,560 probably null Het
Med12l T G 3: 59,257,223 probably null Het
Mfsd10 G T 5: 34,635,625 T44N probably damaging Het
Mrps27 T C 13: 99,405,041 S218P probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Neil2 A C 14: 63,191,841 M1R probably null Het
Nelfcd T C 2: 174,427,048 F587L probably damaging Het
Nfil3 T C 13: 52,968,799 D23G probably benign Het
Nit2 T C 16: 57,157,160 K169R probably benign Het
Nxt1 T C 2: 148,675,347 S3P probably benign Het
Ogt A G X: 101,667,525 N434D probably damaging Het
Olfr679 T A 7: 105,085,787 S24T possibly damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rsl1 T C 13: 67,177,162 probably null Het
Sobp G A 10: 43,022,900 H230Y probably damaging Het
Sptan1 A G 2: 30,026,588 E2096G probably damaging Het
Tie1 G T 4: 118,478,405 S797* probably null Het
Tmem266 T C 9: 55,418,107 I186T probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tnfaip6 T C 2: 52,050,864 F139S probably damaging Het
Tnrc6a T C 7: 123,171,680 S898P probably benign Het
Trim24 A G 6: 37,964,740 D911G probably damaging Het
Tyw5 T C 1: 57,388,488 probably benign Het
Ubr3 C T 2: 70,016,385 Q1651* probably null Het
Unc13c T A 9: 73,530,952 I1943F possibly damaging Het
Usp47 T A 7: 112,110,048 S1334T probably damaging Het
Vmn1r215 T A 13: 23,075,931 V47E probably benign Het
Vmn1r224 T A 17: 20,419,362 M67K possibly damaging Het
Wdfy3 T A 5: 101,922,634 probably null Het
Zfc3h1 T C 10: 115,418,799 Y1433H probably benign Het
Other mutations in Kdm2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Kdm2a APN 19 4356898 missense possibly damaging 0.94
IGL00679:Kdm2a APN 19 4326841 missense probably damaging 1.00
IGL01104:Kdm2a APN 19 4356738 splice site probably benign
IGL01161:Kdm2a APN 19 4319251 missense probably benign 0.04
IGL01433:Kdm2a APN 19 4342860 missense possibly damaging 0.83
IGL01456:Kdm2a APN 19 4351755 missense probably damaging 1.00
IGL01467:Kdm2a APN 19 4324407 missense probably damaging 0.99
IGL01517:Kdm2a APN 19 4362061 splice site probably benign
IGL01528:Kdm2a APN 19 4343055 missense probably benign 0.18
IGL02504:Kdm2a APN 19 4356771 missense possibly damaging 0.92
IGL02895:Kdm2a APN 19 4362902 missense probably damaging 1.00
IGL03109:Kdm2a APN 19 4329107 missense probably benign 0.04
IGL03171:Kdm2a APN 19 4356764 missense probably damaging 1.00
IGL03256:Kdm2a APN 19 4345510 unclassified probably benign
BB009:Kdm2a UTSW 19 4319156 missense probably damaging 0.98
BB019:Kdm2a UTSW 19 4319156 missense probably damaging 0.98
P0027:Kdm2a UTSW 19 4343245 splice site probably benign
PIT4382001:Kdm2a UTSW 19 4343173 missense probably benign
R0220:Kdm2a UTSW 19 4324919 missense possibly damaging 0.85
R0961:Kdm2a UTSW 19 4329191 missense probably benign 0.07
R1662:Kdm2a UTSW 19 4328212 missense probably damaging 1.00
R2023:Kdm2a UTSW 19 4322464 missense probably damaging 0.98
R2191:Kdm2a UTSW 19 4356931 splice site probably null
R2207:Kdm2a UTSW 19 4362870 missense probably damaging 1.00
R2351:Kdm2a UTSW 19 4329126 missense probably benign 0.02
R2406:Kdm2a UTSW 19 4322518 missense probably damaging 1.00
R2882:Kdm2a UTSW 19 4331184 critical splice donor site probably null
R3788:Kdm2a UTSW 19 4351805 missense probably damaging 0.99
R3792:Kdm2a UTSW 19 4324512 missense possibly damaging 0.91
R3950:Kdm2a UTSW 19 4343232 missense possibly damaging 0.89
R4377:Kdm2a UTSW 19 4329054 missense probably benign 0.01
R4466:Kdm2a UTSW 19 4320300 missense probably damaging 0.99
R4766:Kdm2a UTSW 19 4324507 unclassified probably benign
R4824:Kdm2a UTSW 19 4362787 missense probably damaging 1.00
R4838:Kdm2a UTSW 19 4325026 missense probably benign 0.41
R5283:Kdm2a UTSW 19 4331269 missense probably benign 0.00
R6366:Kdm2a UTSW 19 4324932 missense probably benign 0.15
R6368:Kdm2a UTSW 19 4350317 missense probably damaging 1.00
R6522:Kdm2a UTSW 19 4324826 missense possibly damaging 0.49
R6716:Kdm2a UTSW 19 4329102 missense probably damaging 1.00
R6757:Kdm2a UTSW 19 4319243 missense probably damaging 0.98
R6912:Kdm2a UTSW 19 4322501 missense probably benign 0.06
R6996:Kdm2a UTSW 19 4345641 missense probably benign 0.16
R7090:Kdm2a UTSW 19 4319141 missense probably damaging 1.00
R7497:Kdm2a UTSW 19 4324376 missense probably damaging 1.00
R7542:Kdm2a UTSW 19 4333830 start gained probably benign
R7932:Kdm2a UTSW 19 4319156 missense probably damaging 0.98
R8199:Kdm2a UTSW 19 4389026 missense unknown
R8263:Kdm2a UTSW 19 4324364 missense possibly damaging 0.88
R8446:Kdm2a UTSW 19 4356888 nonsense probably null
RF046:Kdm2a UTSW 19 4324507 unclassified probably benign
X0028:Kdm2a UTSW 19 4320271 missense possibly damaging 0.77
X0028:Kdm2a UTSW 19 4348746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCCAAACTGCATTGCATC -3'
(R):5'- GCCTGACTCTGAGGTAGAAAATG -3'

Sequencing Primer
(F):5'- GCATTGCATCAGTTCTAAGCAGC -3'
(R):5'- CTGAGGTAGAAAATGACAGAGATTTC -3'
Posted On2015-06-12