Incidental Mutation 'R4235:Ogt'
ID321100
Institutional Source Beutler Lab
Gene Symbol Ogt
Ensembl Gene ENSMUSG00000034160
Gene NameO-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)
SynonymsOGT, 1110038P24Rik, Ogtl, 4831420N21Rik
MMRRC Submission 041052-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R4235 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location101640060-101684351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101667525 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 434 (N434D)
Ref Sequence ENSEMBL: ENSMUSP00000113454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044475] [ENSMUST00000119299]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044475
AA Change: N444D

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045409
Gene: ENSMUSG00000034160
AA Change: N444D

DomainStartEndE-ValueType
TPR 21 54 9.73e1 SMART
TPR 89 122 7.1e-10 SMART
TPR 123 156 1.11e-2 SMART
TPR 157 190 5.64e-4 SMART
TPR 191 224 1.18e-6 SMART
TPR 225 258 2e-4 SMART
TPR 259 292 6.33e-7 SMART
TPR 293 326 4.48e-7 SMART
TPR 327 360 3.64e-7 SMART
TPR 361 394 7.8e-7 SMART
TPR 395 428 7.27e-7 SMART
TPR 429 462 2.91e-6 SMART
Pfam:Glyco_transf_41 556 1024 1.1e-258 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119299
AA Change: N434D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113454
Gene: ENSMUSG00000034160
AA Change: N434D

DomainStartEndE-ValueType
TPR 79 112 7.1e-10 SMART
TPR 113 146 1.11e-2 SMART
TPR 147 180 5.64e-4 SMART
TPR 181 214 1.18e-6 SMART
TPR 215 248 2e-4 SMART
TPR 249 282 6.33e-7 SMART
TPR 283 316 4.48e-7 SMART
TPR 317 350 3.64e-7 SMART
TPR 351 384 7.8e-7 SMART
TPR 385 418 7.27e-7 SMART
TPR 419 452 2.91e-6 SMART
Pfam:Glyco_transf_41 546 1014 2.6e-280 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147635
Meta Mutation Damage Score 0.1552 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyltransferase that catalyzes the addition of a single N-acetylglucosamine in O-glycosidic linkage to serine or threonine residues. Since both phosphorylation and glycosylation compete for similar serine or threonine residues, the two processes may compete for sites, or they may alter the substrate specificity of nearby sites by steric or electrostatic effects. The protein contains multiple tetratricopeptide repeats that are required for optimal recognition of substrates. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Conditional deletion of this gene results in cell death in hemizygous and homozygous cells. Following germline conditional deletion only females inheriting the deletion paternally survive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
5730596B20Rik G T 6: 52,178,961 probably benign Het
9530053A07Rik T A 7: 28,156,648 D1953E probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Bnc2 A G 4: 84,293,514 V231A probably damaging Het
Bod1l A G 5: 41,821,455 S839P probably damaging Het
Casp8 T A 1: 58,833,698 H264Q possibly damaging Het
Cc2d1b A T 4: 108,625,352 probably benign Het
Cpne6 A T 14: 55,513,600 probably benign Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dgkd T A 1: 87,931,982 L774* probably null Het
Fbxl2 T A 9: 113,989,163 N205I probably benign Het
Fkbp15 A T 4: 62,336,456 I269K probably benign Het
Gm13023 G C 4: 143,794,774 C320S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Has1 G T 17: 17,850,036 R208S possibly damaging Het
Hecw1 C G 13: 14,317,139 A423P probably benign Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Ifi208 T G 1: 173,682,911 S211A probably benign Het
Ighv6-3 T C 12: 114,391,874 E65G probably damaging Het
Igkv9-120 A T 6: 68,050,333 D77V probably benign Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm2a A G 19: 4,322,521 I932T probably damaging Het
Krt17 T C 11: 100,257,868 T279A possibly damaging Het
Lamp1 T C 8: 13,167,192 V67A possibly damaging Het
Limk1 T C 5: 134,670,478 I142V probably benign Het
Mamdc2 T C 19: 23,374,017 N182D possibly damaging Het
Mcpt1 G A 14: 56,018,560 probably null Het
Med12l T G 3: 59,257,223 probably null Het
Mfsd10 G T 5: 34,635,625 T44N probably damaging Het
Mrps27 T C 13: 99,405,041 S218P probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Neil2 A C 14: 63,191,841 M1R probably null Het
Nelfcd T C 2: 174,427,048 F587L probably damaging Het
Nfil3 T C 13: 52,968,799 D23G probably benign Het
Nit2 T C 16: 57,157,160 K169R probably benign Het
Nxt1 T C 2: 148,675,347 S3P probably benign Het
Olfr679 T A 7: 105,085,787 S24T possibly damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rsl1 T C 13: 67,177,162 probably null Het
Sobp G A 10: 43,022,900 H230Y probably damaging Het
Sptan1 A G 2: 30,026,588 E2096G probably damaging Het
Tie1 G T 4: 118,478,405 S797* probably null Het
Tmem266 T C 9: 55,418,107 I186T probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tnfaip6 T C 2: 52,050,864 F139S probably damaging Het
Tnrc6a T C 7: 123,171,680 S898P probably benign Het
Trim24 A G 6: 37,964,740 D911G probably damaging Het
Tyw5 T C 1: 57,388,488 probably benign Het
Ubr3 C T 2: 70,016,385 Q1651* probably null Het
Unc13c T A 9: 73,530,952 I1943F possibly damaging Het
Usp47 T A 7: 112,110,048 S1334T probably damaging Het
Vmn1r215 T A 13: 23,075,931 V47E probably benign Het
Vmn1r224 T A 17: 20,419,362 M67K possibly damaging Het
Wdfy3 T A 5: 101,922,634 probably null Het
Zfc3h1 T C 10: 115,418,799 Y1433H probably benign Het
Other mutations in Ogt
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0883:Ogt UTSW X 101644199 splice site probably benign
R1688:Ogt UTSW X 101655690 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTTATACTCGTGCCATCC -3'
(R):5'- AAAGCTGCCCTATGACTGCC -3'

Sequencing Primer
(F):5'- ATACTCGTGCCATCCAGATTAATC -3'
(R):5'- AACACTGTCTTGTCTCTAAACAGGC -3'
Posted On2015-06-12