Incidental Mutation 'R4237:Rad54l'
ID321155
Institutional Source Beutler Lab
Gene Symbol Rad54l
Ensembl Gene ENSMUSG00000028702
Gene NameRAD54 like (S. cerevisiae)
SynonymsRAD54
MMRRC Submission 041054-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4237 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location116094264-116123690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116099449 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 500 (V500A)
Ref Sequence ENSEMBL: ENSMUSP00000099766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030471] [ENSMUST00000102704] [ENSMUST00000102705]
Predicted Effect probably benign
Transcript: ENSMUST00000030471
SMART Domains Protein: ENSMUSP00000030471
Gene: ENSMUSG00000028703

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 352 382 N/A INTRINSIC
low complexity region 417 429 N/A INTRINSIC
SCOP:d1yrga_ 449 742 4e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102704
AA Change: V500A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099765
Gene: ENSMUSG00000028702
AA Change: V500A

DomainStartEndE-ValueType
DEXDc 149 357 1.66e-41 SMART
Blast:DEXDc 391 427 5e-13 BLAST
low complexity region 441 456 N/A INTRINSIC
HELICc 527 611 1.39e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102705
AA Change: V500A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099766
Gene: ENSMUSG00000028702
AA Change: V500A

DomainStartEndE-ValueType
Pfam:Rad54_N 10 138 7.8e-9 PFAM
DEXDc 149 357 1.66e-41 SMART
Blast:DEXDc 391 427 5e-13 BLAST
low complexity region 441 456 N/A INTRINSIC
HELICc 527 611 1.39e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139147
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the DEAD-like helicase superfamily, and shares similarity with Saccharomyces cerevisiae Rad54, a protein known to be involved in the homologous recombination and repair of DNA. This protein has been shown to play a role in homologous recombination related repair of DNA double-strand breaks. The binding of this protein to double-strand DNA induces a DNA topological change, which is thought to facilitate homologous DNA paring, and stimulate DNA recombination. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are sensitive to DNA crosslinking agents and to ionizing radiation and show abnormal definitive hematopoiesis following X-ray treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
6820408C15Rik C T 2: 152,428,953 T32I possibly damaging Het
Abca13 A G 11: 9,434,188 K3880R probably benign Het
Ahnak C T 19: 9,001,783 L144F probably benign Het
Antxr2 A T 5: 97,938,407 I447N probably damaging Het
Cdc20 C T 4: 118,433,060 R468Q probably damaging Het
Clip2 A G 5: 134,535,197 probably benign Het
Cntnap2 A T 6: 46,530,390 probably benign Het
Ddi1 A G 9: 6,265,799 M190T probably benign Het
Dicer1 A G 12: 104,729,228 V148A possibly damaging Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Galnt11 G A 5: 25,265,260 R569Q probably benign Het
Gpr6 T C 10: 41,070,608 N326S probably damaging Het
Hexb T C 13: 97,176,751 probably benign Het
Ighv3-4 A T 12: 114,253,913 D19E probably benign Het
L3mbtl3 G A 10: 26,340,948 A181V unknown Het
Lrrc37a G A 11: 103,502,289 T770I probably damaging Het
Olfr1120 T C 2: 87,358,253 S270P probably damaging Het
Olfr2 T C 7: 107,001,329 N177S probably damaging Het
Olfr715 A G 7: 107,129,037 S119P probably damaging Het
Olfr850 C T 9: 19,477,597 V215I probably benign Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Ppp1r13b T C 12: 111,838,736 T181A probably benign Het
Prc1 G A 7: 80,311,216 probably benign Het
Proca1 A G 11: 78,204,926 N128S probably benign Het
Psmd8 G A 7: 29,177,121 P155L probably damaging Het
Scamp3 G A 3: 89,181,927 probably null Het
Serpinb10 C T 1: 107,538,449 T55M probably benign Het
Sipa1l2 T C 8: 125,491,656 E314G probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Tdrd9 C T 12: 112,067,625 R1334* probably null Het
Trank1 A G 9: 111,367,035 I1376V probably benign Het
Trim28 T A 7: 13,027,911 H268Q possibly damaging Het
Vmn2r76 T A 7: 86,230,532 I187L probably benign Het
Wdr95 A T 5: 149,563,337 R160* probably null Het
Wnt5a T C 14: 28,522,866 C357R probably damaging Het
Zfp157 A G 5: 138,447,541 I53V probably damaging Het
Zfp184 G A 13: 21,958,778 R218H probably damaging Het
Other mutations in Rad54l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Rad54l APN 4 116105877 missense probably damaging 1.00
IGL01569:Rad54l APN 4 116098998 missense probably damaging 1.00
IGL02120:Rad54l APN 4 116098984 missense probably benign 0.44
IGL02587:Rad54l APN 4 116105797 missense probably damaging 1.00
IGL02728:Rad54l APN 4 116122949 missense probably benign 0.00
IGL03114:Rad54l APN 4 116098532 missense probably damaging 1.00
R0690:Rad54l UTSW 4 116099750 splice site probably benign
R1179:Rad54l UTSW 4 116111320 missense probably benign 0.14
R1956:Rad54l UTSW 4 116110357 missense probably damaging 0.99
R2875:Rad54l UTSW 4 116101853 missense probably benign 0.00
R2936:Rad54l UTSW 4 116122879 intron probably benign
R4344:Rad54l UTSW 4 116097354 missense probably damaging 1.00
R4801:Rad54l UTSW 4 116122924 missense probably null 0.12
R4802:Rad54l UTSW 4 116122924 missense probably null 0.12
R5106:Rad54l UTSW 4 116099764 intron probably benign
R5644:Rad54l UTSW 4 116098947 missense probably benign
R5684:Rad54l UTSW 4 116100563 missense probably damaging 1.00
R5883:Rad54l UTSW 4 116099046 intron probably benign
R5963:Rad54l UTSW 4 116110387 missense probably damaging 1.00
R6035:Rad54l UTSW 4 116097469 missense probably damaging 1.00
R6035:Rad54l UTSW 4 116097469 missense probably damaging 1.00
R6369:Rad54l UTSW 4 116111189 critical splice donor site probably null
R6863:Rad54l UTSW 4 116099669 missense probably damaging 1.00
R7135:Rad54l UTSW 4 116105830 missense probably damaging 1.00
R7318:Rad54l UTSW 4 116110709 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGTCCTCATATAGCCACACCTTG -3'
(R):5'- CAGATGGTCAGTCTCCTTGG -3'

Sequencing Primer
(F):5'- ATCATTTTCCTAGAGTGTCAGTGAG -3'
(R):5'- TCCTTGGAGGAGGGAATATAGG -3'
Posted On2015-06-12