Incidental Mutation 'R4238:Trpa1'
ID321195
Institutional Source Beutler Lab
Gene Symbol Trpa1
Ensembl Gene ENSMUSG00000032769
Gene Nametransient receptor potential cation channel, subfamily A, member 1
SynonymsANKTM1
MMRRC Submission 041055-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R4238 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location14872648-14918862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14884116 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 853 (L853P)
Ref Sequence ENSEMBL: ENSMUSP00000043594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041447]
Predicted Effect probably damaging
Transcript: ENSMUST00000041447
AA Change: L853P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043594
Gene: ENSMUSG00000032769
AA Change: L853P

DomainStartEndE-ValueType
ANK 63 94 1.01e2 SMART
ANK 98 127 9.7e-8 SMART
ANK 131 161 1.36e-2 SMART
ANK 165 194 5.45e-2 SMART
ANK 198 226 3.07e2 SMART
ANK 239 268 1.99e-4 SMART
ANK 272 302 1.33e2 SMART
ANK 309 338 4.19e-3 SMART
ANK 342 371 2.34e-1 SMART
ANK 413 442 3.41e-3 SMART
ANK 446 475 5.75e-1 SMART
ANK 482 511 4.1e-6 SMART
ANK 514 543 1.68e-2 SMART
ANK 548 577 4.97e-5 SMART
Blast:ANK 580 609 2e-11 BLAST
Pfam:Ion_trans 736 975 1.8e-11 PFAM
Meta Mutation Damage Score 0.6344 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The structure of the protein encoded by this gene is highly related to both the protein ankyrin and transmembrane proteins. The specific function of this protein has not yet been determined; however, studies indicate the function may involve a role in signal transduction and growth control. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in altered nociception and neuron responses to isothiocyanate or thiosulfinate compounds like those found in mustard oil and garlic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik C T 13: 119,466,942 P93S probably benign Het
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
Aar2 A G 2: 156,551,144 E151G possibly damaging Het
Cacna2d4 A G 6: 119,240,708 D125G probably null Het
Cdc20 C T 4: 118,433,060 R468Q probably damaging Het
Cers3 T C 7: 66,773,676 F87S probably damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Cndp1 G T 18: 84,618,217 H391N probably benign Het
Cpz T C 5: 35,502,474 D609G probably benign Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fam186a T C 15: 99,943,642 I1574V probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Gpr158 G T 2: 21,368,551 C99F probably damaging Het
Gtf2h1 C T 7: 46,805,065 A157V probably benign Het
Hexb T C 13: 97,176,751 probably benign Het
Ighv3-4 A T 12: 114,253,913 D19E probably benign Het
Igkv12-44 A G 6: 69,814,884 S32P probably benign Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Lin54 G A 5: 100,475,744 S78L possibly damaging Het
Lzts1 G T 8: 69,135,927 A459E possibly damaging Het
Mlf1 G A 3: 67,384,577 S25N probably benign Het
Mrgprx2 C A 7: 48,482,990 V27L probably benign Het
Myof T A 19: 37,923,008 R1505* probably null Het
Olfr727 T C 14: 50,127,432 V285A probably benign Het
Otud7a A G 7: 63,650,954 D47G probably damaging Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prc1 G A 7: 80,311,216 probably benign Het
Psg20 A T 7: 18,684,509 V111D probably damaging Het
Scamp3 G A 3: 89,181,927 probably null Het
Simc1 C G 13: 54,526,260 S807* probably null Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Snrpa A T 7: 27,192,868 probably null Het
Sval2 T A 6: 41,860,349 L4H probably damaging Het
Tax1bp1 C T 6: 52,766,051 Q808* probably null Het
Tnfrsf11a T C 1: 105,827,237 Y345H probably damaging Het
Trpm3 A G 19: 22,978,638 R1155G probably damaging Het
Ube4a T C 9: 44,939,999 E739G probably damaging Het
Zfp433 A C 10: 81,720,212 T182P probably damaging Het
Other mutations in Trpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Trpa1 APN 1 14891333 missense probably damaging 0.97
IGL00937:Trpa1 APN 1 14880277 splice site probably benign
IGL00957:Trpa1 APN 1 14881668 missense probably damaging 0.99
IGL01307:Trpa1 APN 1 14896547 missense probably benign 0.23
IGL01336:Trpa1 APN 1 14886880 splice site probably benign
IGL01408:Trpa1 APN 1 14889413 missense probably benign 0.03
IGL01504:Trpa1 APN 1 14882219 missense possibly damaging 0.79
IGL01543:Trpa1 APN 1 14900076 missense probably damaging 1.00
IGL01609:Trpa1 APN 1 14912383 missense probably damaging 0.99
IGL01895:Trpa1 APN 1 14887643 missense possibly damaging 0.87
IGL02449:Trpa1 APN 1 14898157 missense probably damaging 1.00
IGL02936:Trpa1 APN 1 14875969 splice site probably null
fear-2 UTSW 1 14891303 critical splice donor site probably null
petrified UTSW 1 14884116 missense probably damaging 1.00
R0008:Trpa1 UTSW 1 14903215 missense possibly damaging 0.53
R0008:Trpa1 UTSW 1 14903215 missense possibly damaging 0.53
R0317:Trpa1 UTSW 1 14881632 missense probably benign 0.03
R0454:Trpa1 UTSW 1 14885748 critical splice donor site probably null
R0828:Trpa1 UTSW 1 14875884 missense probably damaging 1.00
R0944:Trpa1 UTSW 1 14912361 splice site probably null
R0962:Trpa1 UTSW 1 14898163 missense possibly damaging 0.61
R1025:Trpa1 UTSW 1 14904183 missense probably benign 0.01
R1035:Trpa1 UTSW 1 14891303 critical splice donor site probably null
R1134:Trpa1 UTSW 1 14881748 missense possibly damaging 0.95
R1278:Trpa1 UTSW 1 14918723 critical splice donor site probably null
R1497:Trpa1 UTSW 1 14885812 missense probably benign 0.30
R1617:Trpa1 UTSW 1 14873675 missense probably damaging 1.00
R1800:Trpa1 UTSW 1 14874424 missense probably benign 0.04
R1856:Trpa1 UTSW 1 14899388 nonsense probably null
R1886:Trpa1 UTSW 1 14889425 missense probably benign 0.00
R2004:Trpa1 UTSW 1 14905983 missense possibly damaging 0.83
R2152:Trpa1 UTSW 1 14899401 missense probably damaging 1.00
R2172:Trpa1 UTSW 1 14881656 missense probably benign 0.01
R2198:Trpa1 UTSW 1 14910746 missense probably benign
R2221:Trpa1 UTSW 1 14903256 missense probably null 0.12
R2223:Trpa1 UTSW 1 14903256 missense probably null 0.12
R2307:Trpa1 UTSW 1 14912381 missense probably benign 0.00
R2338:Trpa1 UTSW 1 14884245 missense probably damaging 0.97
R2698:Trpa1 UTSW 1 14905998 missense probably damaging 1.00
R2872:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2872:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2873:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2874:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R3418:Trpa1 UTSW 1 14874381 missense probably benign 0.01
R3419:Trpa1 UTSW 1 14874381 missense probably benign 0.01
R3796:Trpa1 UTSW 1 14893264 missense possibly damaging 0.74
R3799:Trpa1 UTSW 1 14893264 missense possibly damaging 0.74
R4320:Trpa1 UTSW 1 14874452 missense probably benign 0.00
R4591:Trpa1 UTSW 1 14882108 splice site probably null
R4834:Trpa1 UTSW 1 14896523 missense possibly damaging 0.72
R4991:Trpa1 UTSW 1 14910746 missense probably benign 0.00
R4999:Trpa1 UTSW 1 14875861 missense probably benign 0.05
R5038:Trpa1 UTSW 1 14910866 missense probably damaging 1.00
R5055:Trpa1 UTSW 1 14875959 missense probably damaging 1.00
R5158:Trpa1 UTSW 1 14881661 missense probably benign 0.01
R5193:Trpa1 UTSW 1 14875917 missense possibly damaging 0.92
R5558:Trpa1 UTSW 1 14898268 missense probably damaging 1.00
R5578:Trpa1 UTSW 1 14887008 missense probably damaging 1.00
R5680:Trpa1 UTSW 1 14875854 missense probably benign 0.00
R5738:Trpa1 UTSW 1 14875950 missense probably damaging 1.00
R5801:Trpa1 UTSW 1 14898078 missense probably damaging 1.00
R5945:Trpa1 UTSW 1 14898135 missense probably benign 0.03
R6092:Trpa1 UTSW 1 14889486 missense probably damaging 1.00
R6776:Trpa1 UTSW 1 14912377 missense probably benign
R7126:Trpa1 UTSW 1 14890424 missense probably benign 0.00
R7154:Trpa1 UTSW 1 14882233 missense possibly damaging 0.46
R7175:Trpa1 UTSW 1 14893207 missense possibly damaging 0.90
R7258:Trpa1 UTSW 1 14903249 missense probably damaging 1.00
R7358:Trpa1 UTSW 1 14898110 missense probably damaging 1.00
R7412:Trpa1 UTSW 1 14884198 missense probably benign 0.43
R7639:Trpa1 UTSW 1 14886913 missense probably benign 0.00
R7740:Trpa1 UTSW 1 14912401 missense possibly damaging 0.72
R7815:Trpa1 UTSW 1 14904262 missense probably benign 0.01
R7854:Trpa1 UTSW 1 14881694 missense probably benign 0.00
R7937:Trpa1 UTSW 1 14881694 missense probably benign 0.00
X0028:Trpa1 UTSW 1 14890420 missense probably benign 0.16
Z1176:Trpa1 UTSW 1 14881692 missense probably damaging 1.00
Z1176:Trpa1 UTSW 1 14891306 missense possibly damaging 0.80
Z1176:Trpa1 UTSW 1 14898350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCTACACATTGAATTTCAGAGCC -3'
(R):5'- TGTCAGATTTCTCCATGTGGTC -3'

Sequencing Primer
(F):5'- ACATTGAATTTCAGAGCCCTCTAC -3'
(R):5'- CCTTCCTTCTCTATCCAGAAAAGG -3'
Posted On2015-06-12