Mutagenetix > Incidental Mutations

Incidental Mutation 'R4238:Trpa1'

321195

Institutional Source

Beutler Lab

Gene Symbol

Trpa1

Ensembl Gene

ENSMUSG00000032769

Gene Name

transient receptor potential cation channel, subfamily A, member 1

Synonyms

ANKTM1

MMRRC Submission

041055-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.150) question?

Stock #

R4238 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14872648-14918862 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 14884116 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 853 (L853P)

Ref Sequence

ENSEMBL: ENSMUSP00000043594 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041447]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041447
AA Change: L853P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043594
Gene: ENSMUSG00000032769
AA Change: L853P

Domain	Start	End	E-Value	Type
ANK	63	94	1.01e2	SMART
ANK	98	127	9.7e-8	SMART
ANK	131	161	1.36e-2	SMART
ANK	165	194	5.45e-2	SMART
ANK	198	226	3.07e2	SMART
ANK	239	268	1.99e-4	SMART
ANK	272	302	1.33e2	SMART
ANK	309	338	4.19e-3	SMART
ANK	342	371	2.34e-1	SMART
ANK	413	442	3.41e-3	SMART
ANK	446	475	5.75e-1	SMART
ANK	482	511	4.1e-6	SMART
ANK	514	543	1.68e-2	SMART
ANK	548	577	4.97e-5	SMART
Blast:ANK	580	609	2e-11	BLAST
Pfam:Ion_trans	736	975	1.8e-11	PFAM

Meta Mutation Damage Score

0.6344

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 96.0%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The structure of the protein encoded by this gene is highly related to both the protein ankyrin and transmembrane proteins. The specific function of this protein has not yet been determined; however, studies indicate the function may involve a role in signal transduction and growth control. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in altered nociception and neuron responses to isothiocyanate or thiosulfinate compounds like those found in mustard oil and garlic. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	C	T	13: 119,466,942	P93S	probably benign	Het
4930563M21Rik	T	C	9: 55,980,842	D397G	probably benign	Het
Aar2	A	G	2: 156,551,144	E151G	possibly damaging	Het
Cacna2d4	A	G	6: 119,240,708	D125G	probably null	Het
Cdc20	C	T	4: 118,433,060	R468Q	probably damaging	Het
Cers3	T	C	7: 66,773,676	F87S	probably damaging	Het
Cfap74	C	A	4: 155,463,072	H1238Q	probably benign	Het
Cndp1	G	T	18: 84,618,217	H391N	probably benign	Het
Cpz	T	C	5: 35,502,474	D609G	probably benign	Het
Dpp8	A	G	9: 65,054,923	D415G	probably benign	Het
Erbb2	A	G	11: 98,428,043	K549R	probably benign	Het
Fam186a	T	C	15: 99,943,642	I1574V	probably benign	Het
Gm6871	G	T	7: 41,545,780	T511K	probably damaging	Het
Gpr158	G	T	2: 21,368,551	C99F	probably damaging	Het
Gtf2h1	C	T	7: 46,805,065	A157V	probably benign	Het
Hexb	T	C	13: 97,176,751		probably benign	Het
Ighv3-4	A	T	12: 114,253,913	D19E	probably benign	Het
Igkv12-44	A	G	6: 69,814,884	S32P	probably benign	Het
Klk6	A	G	7: 43,829,173	H168R	probably benign	Het
Lin54	G	A	5: 100,475,744	S78L	possibly damaging	Het
Lzts1	G	T	8: 69,135,927	A459E	possibly damaging	Het
Mlf1	G	A	3: 67,384,577	S25N	probably benign	Het
Mrgprx2	C	A	7: 48,482,990	V27L	probably benign	Het
Myof	T	A	19: 37,923,008	R1505*	probably null	Het
Olfr727	T	C	14: 50,127,432	V285A	probably benign	Het
Otud7a	A	G	7: 63,650,954	D47G	probably damaging	Het
Phactr1	T	A	13: 43,094,887	N437K	possibly damaging	Het
Polq	G	T	16: 37,013,181	V79F	probably damaging	Het
Prc1	G	A	7: 80,311,216		probably benign	Het
Psg20	A	T	7: 18,684,509	V111D	probably damaging	Het
Scamp3	G	A	3: 89,181,927		probably null	Het
Simc1	C	G	13: 54,526,260	S807*	probably null	Het
Slc14a2	G	A	18: 78,207,068	R62C	probably damaging	Het
Snrpa	A	T	7: 27,192,868		probably null	Het
Sval2	T	A	6: 41,860,349	L4H	probably damaging	Het
Tax1bp1	C	T	6: 52,766,051	Q808*	probably null	Het
Tnfrsf11a	T	C	1: 105,827,237	Y345H	probably damaging	Het
Trpm3	A	G	19: 22,978,638	R1155G	probably damaging	Het
Ube4a	T	C	9: 44,939,999	E739G	probably damaging	Het
Zfp433	A	C	10: 81,720,212	T182P	probably damaging	Het

Other mutations in Trpa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00801:Trpa1	APN	1	14891333	missense	probably damaging	0.97
IGL00937:Trpa1	APN	1	14880277	splice site	probably benign
IGL00957:Trpa1	APN	1	14881668	missense	probably damaging	0.99
IGL01307:Trpa1	APN	1	14896547	missense	probably benign	0.23
IGL01336:Trpa1	APN	1	14886880	splice site	probably benign
IGL01408:Trpa1	APN	1	14889413	missense	probably benign	0.03
IGL01504:Trpa1	APN	1	14882219	missense	possibly damaging	0.79
IGL01543:Trpa1	APN	1	14900076	missense	probably damaging	1.00
IGL01609:Trpa1	APN	1	14912383	missense	probably damaging	0.99
IGL01895:Trpa1	APN	1	14887643	missense	possibly damaging	0.87
IGL02449:Trpa1	APN	1	14898157	missense	probably damaging	1.00
IGL02936:Trpa1	APN	1	14875969	splice site	probably null
fear-2	UTSW	1	14891303	critical splice donor site	probably null
petrified	UTSW	1	14884116	missense	probably damaging	1.00
R0008:Trpa1	UTSW	1	14903215	missense	possibly damaging	0.53
R0008:Trpa1	UTSW	1	14903215	missense	possibly damaging	0.53
R0317:Trpa1	UTSW	1	14881632	missense	probably benign	0.03
R0454:Trpa1	UTSW	1	14885748	critical splice donor site	probably null
R0828:Trpa1	UTSW	1	14875884	missense	probably damaging	1.00
R0944:Trpa1	UTSW	1	14912361	splice site	probably null
R0962:Trpa1	UTSW	1	14898163	missense	possibly damaging	0.61
R1025:Trpa1	UTSW	1	14904183	missense	probably benign	0.01
R1035:Trpa1	UTSW	1	14891303	critical splice donor site	probably null
R1134:Trpa1	UTSW	1	14881748	missense	possibly damaging	0.95
R1278:Trpa1	UTSW	1	14918723	critical splice donor site	probably null
R1497:Trpa1	UTSW	1	14885812	missense	probably benign	0.30
R1617:Trpa1	UTSW	1	14873675	missense	probably damaging	1.00
R1800:Trpa1	UTSW	1	14874424	missense	probably benign	0.04
R1856:Trpa1	UTSW	1	14899388	nonsense	probably null
R1886:Trpa1	UTSW	1	14889425	missense	probably benign	0.00
R2004:Trpa1	UTSW	1	14905983	missense	possibly damaging	0.83
R2152:Trpa1	UTSW	1	14899401	missense	probably damaging	1.00
R2172:Trpa1	UTSW	1	14881656	missense	probably benign	0.01
R2198:Trpa1	UTSW	1	14910746	missense	probably benign
R2221:Trpa1	UTSW	1	14903256	missense	probably null	0.12
R2223:Trpa1	UTSW	1	14903256	missense	probably null	0.12
R2307:Trpa1	UTSW	1	14912381	missense	probably benign	0.00
R2338:Trpa1	UTSW	1	14884245	missense	probably damaging	0.97
R2698:Trpa1	UTSW	1	14905998	missense	probably damaging	1.00
R2872:Trpa1	UTSW	1	14887620	missense	probably damaging	1.00
R2872:Trpa1	UTSW	1	14887620	missense	probably damaging	1.00
R2873:Trpa1	UTSW	1	14887620	missense	probably damaging	1.00
R2874:Trpa1	UTSW	1	14887620	missense	probably damaging	1.00
R3418:Trpa1	UTSW	1	14874381	missense	probably benign	0.01
R3419:Trpa1	UTSW	1	14874381	missense	probably benign	0.01
R3796:Trpa1	UTSW	1	14893264	missense	possibly damaging	0.74
R3799:Trpa1	UTSW	1	14893264	missense	possibly damaging	0.74
R4320:Trpa1	UTSW	1	14874452	missense	probably benign	0.00
R4591:Trpa1	UTSW	1	14882108	splice site	probably null
R4834:Trpa1	UTSW	1	14896523	missense	possibly damaging	0.72
R4991:Trpa1	UTSW	1	14910746	missense	probably benign	0.00
R4999:Trpa1	UTSW	1	14875861	missense	probably benign	0.05
R5038:Trpa1	UTSW	1	14910866	missense	probably damaging	1.00
R5055:Trpa1	UTSW	1	14875959	missense	probably damaging	1.00
R5158:Trpa1	UTSW	1	14881661	missense	probably benign	0.01
R5193:Trpa1	UTSW	1	14875917	missense	possibly damaging	0.92
R5558:Trpa1	UTSW	1	14898268	missense	probably damaging	1.00
R5578:Trpa1	UTSW	1	14887008	missense	probably damaging	1.00
R5680:Trpa1	UTSW	1	14875854	missense	probably benign	0.00
R5738:Trpa1	UTSW	1	14875950	missense	probably damaging	1.00
R5801:Trpa1	UTSW	1	14898078	missense	probably damaging	1.00
R5945:Trpa1	UTSW	1	14898135	missense	probably benign	0.03
R6092:Trpa1	UTSW	1	14889486	missense	probably damaging	1.00
R6776:Trpa1	UTSW	1	14912377	missense	probably benign
R7126:Trpa1	UTSW	1	14890424	missense	probably benign	0.00
R7154:Trpa1	UTSW	1	14882233	missense	possibly damaging	0.46
R7175:Trpa1	UTSW	1	14893207	missense	possibly damaging	0.90
R7258:Trpa1	UTSW	1	14903249	missense	probably damaging	1.00
R7358:Trpa1	UTSW	1	14898110	missense	probably damaging	1.00
R7412:Trpa1	UTSW	1	14884198	missense	probably benign	0.43
R7639:Trpa1	UTSW	1	14886913	missense	probably benign	0.00
R7740:Trpa1	UTSW	1	14912401	missense	possibly damaging	0.72
R7815:Trpa1	UTSW	1	14904262	missense	probably benign	0.01
R7854:Trpa1	UTSW	1	14881694	missense	probably benign	0.00
R8112:Trpa1	UTSW	1	14904266	missense	probably benign
R8217:Trpa1	UTSW	1	14887023	missense	probably damaging	0.97
X0028:Trpa1	UTSW	1	14890420	missense	probably benign	0.16
Z1176:Trpa1	UTSW	1	14881692	missense	probably damaging	1.00
Z1176:Trpa1	UTSW	1	14891306	missense	possibly damaging	0.80
Z1176:Trpa1	UTSW	1	14898350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTCTACACATTGAATTTCAGAGCC -3'
(R):5'- TGTCAGATTTCTCCATGTGGTC -3'

Sequencing Primer
(F):5'- ACATTGAATTTCAGAGCCCTCTAC -3'
(R):5'- CCTTCCTTCTCTATCCAGAAAAGG -3'

Posted On

2015-06-12