Incidental Mutation 'R4238:Sval2'
ID321205
Institutional Source Beutler Lab
Gene Symbol Sval2
Ensembl Gene ENSMUSG00000014104
Gene Nameseminal vesicle antigen-like 2
SynonymsSLP-M
MMRRC Submission 041055-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4238 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41852989-41864413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41860349 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 4 (L4H)
Ref Sequence ENSEMBL: ENSMUSP00000014248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014248] [ENSMUST00000119995] [ENSMUST00000120605]
Predicted Effect probably damaging
Transcript: ENSMUST00000014248
AA Change: L4H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000014248
Gene: ENSMUSG00000014104
AA Change: L4H

DomainStartEndE-ValueType
Pfam:SVA 3 124 6.8e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119995
SMART Domains Protein: ENSMUSP00000113701
Gene: ENSMUSG00000014104

DomainStartEndE-ValueType
Pfam:SVA 9 104 5.4e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120605
SMART Domains Protein: ENSMUSP00000113417
Gene: ENSMUSG00000014104

DomainStartEndE-ValueType
Pfam:SVA 1 85 1.4e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143093
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik C T 13: 119,466,942 P93S probably benign Het
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
Aar2 A G 2: 156,551,144 E151G possibly damaging Het
Cacna2d4 A G 6: 119,240,708 D125G probably null Het
Cdc20 C T 4: 118,433,060 R468Q probably damaging Het
Cers3 T C 7: 66,773,676 F87S probably damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Cndp1 G T 18: 84,618,217 H391N probably benign Het
Cpz T C 5: 35,502,474 D609G probably benign Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fam186a T C 15: 99,943,642 I1574V probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Gpr158 G T 2: 21,368,551 C99F probably damaging Het
Gtf2h1 C T 7: 46,805,065 A157V probably benign Het
Hexb T C 13: 97,176,751 probably benign Het
Ighv3-4 A T 12: 114,253,913 D19E probably benign Het
Igkv12-44 A G 6: 69,814,884 S32P probably benign Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Lin54 G A 5: 100,475,744 S78L possibly damaging Het
Lzts1 G T 8: 69,135,927 A459E possibly damaging Het
Mlf1 G A 3: 67,384,577 S25N probably benign Het
Mrgprx2 C A 7: 48,482,990 V27L probably benign Het
Myof T A 19: 37,923,008 R1505* probably null Het
Olfr727 T C 14: 50,127,432 V285A probably benign Het
Otud7a A G 7: 63,650,954 D47G probably damaging Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prc1 G A 7: 80,311,216 probably benign Het
Psg20 A T 7: 18,684,509 V111D probably damaging Het
Scamp3 G A 3: 89,181,927 probably null Het
Simc1 C G 13: 54,526,260 S807* probably null Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Snrpa A T 7: 27,192,868 probably null Het
Tax1bp1 C T 6: 52,766,051 Q808* probably null Het
Tnfrsf11a T C 1: 105,827,237 Y345H probably damaging Het
Trpa1 A G 1: 14,884,116 L853P probably damaging Het
Trpm3 A G 19: 22,978,638 R1155G probably damaging Het
Ube4a T C 9: 44,939,999 E739G probably damaging Het
Zfp433 A C 10: 81,720,212 T182P probably damaging Het
Other mutations in Sval2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02793:Sval2 APN 6 41861861 missense probably benign 0.00
IGL03338:Sval2 APN 6 41864247 missense probably damaging 1.00
R1224:Sval2 UTSW 6 41864254 missense probably benign 0.02
R1912:Sval2 UTSW 6 41864320 makesense probably null
R3968:Sval2 UTSW 6 41861927 missense probably damaging 1.00
R5138:Sval2 UTSW 6 41861945 missense probably damaging 0.99
R8024:Sval2 UTSW 6 41860364 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGATAGTGACCTTTGTTACAGAAG -3'
(R):5'- GGCTTAAGAAGTGACATATTGCTTCAC -3'

Sequencing Primer
(F):5'- TGTTACAGAAGAATAAACAATGTGGC -3'
(R):5'- AGTGACATATTGCTTCACACTTTAG -3'
Posted On2015-06-12