Incidental Mutation 'R4238:Klk6'
ID321212
Institutional Source Beutler Lab
Gene Symbol Klk6
Ensembl Gene ENSMUSG00000050063
Gene Namekallikrein related-peptidase 6
SynonymsBssp, Klk29, neurosin, protease M, Prss18, Prss9
MMRRC Submission 041055-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4238 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location43824499-43832030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43829173 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 168 (H168R)
Ref Sequence ENSEMBL: ENSMUSP00000103602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107966] [ENSMUST00000107967] [ENSMUST00000107968] [ENSMUST00000177514]
Predicted Effect probably benign
Transcript: ENSMUST00000107966
AA Change: H168R

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103600
Gene: ENSMUSG00000050063
AA Change: H168R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 28 244 3.1e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107967
AA Change: H168R

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103601
Gene: ENSMUSG00000050063
AA Change: H168R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 28 244 3.1e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107968
AA Change: H168R

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103602
Gene: ENSMUSG00000050063
AA Change: H168R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 28 244 3.1e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177514
SMART Domains Protein: ENSMUSP00000135591
Gene: ENSMUSG00000050063

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 28 129 5.07e-4 SMART
Meta Mutation Damage Score 0.0735 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kallikrein subfamily of the peptidase S1 family of serine proteases. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. The encoded preproprotein is proteolytically processed to generate the mature protease. Expression of this protease is regulated by steroid hormones and may be elevated in multiple human cancers and in serum from psoriasis patients. The encoded protease may participate in the cleavage of amyloid precursor protein and alpha-synuclein, thus implicating this protease in Alzheimer's and Parkinson's disease, respectively. This gene is located in a gene cluster on chromosome 19. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased mature oligodendrocytes in the developing spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik C T 13: 119,466,942 P93S probably benign Het
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
Aar2 A G 2: 156,551,144 E151G possibly damaging Het
Cacna2d4 A G 6: 119,240,708 D125G probably null Het
Cdc20 C T 4: 118,433,060 R468Q probably damaging Het
Cers3 T C 7: 66,773,676 F87S probably damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Cndp1 G T 18: 84,618,217 H391N probably benign Het
Cpz T C 5: 35,502,474 D609G probably benign Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fam186a T C 15: 99,943,642 I1574V probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Gpr158 G T 2: 21,368,551 C99F probably damaging Het
Gtf2h1 C T 7: 46,805,065 A157V probably benign Het
Hexb T C 13: 97,176,751 probably benign Het
Ighv3-4 A T 12: 114,253,913 D19E probably benign Het
Igkv12-44 A G 6: 69,814,884 S32P probably benign Het
Lin54 G A 5: 100,475,744 S78L possibly damaging Het
Lzts1 G T 8: 69,135,927 A459E possibly damaging Het
Mlf1 G A 3: 67,384,577 S25N probably benign Het
Mrgprx2 C A 7: 48,482,990 V27L probably benign Het
Myof T A 19: 37,923,008 R1505* probably null Het
Olfr727 T C 14: 50,127,432 V285A probably benign Het
Otud7a A G 7: 63,650,954 D47G probably damaging Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prc1 G A 7: 80,311,216 probably benign Het
Psg20 A T 7: 18,684,509 V111D probably damaging Het
Scamp3 G A 3: 89,181,927 probably null Het
Simc1 C G 13: 54,526,260 S807* probably null Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Snrpa A T 7: 27,192,868 probably null Het
Sval2 T A 6: 41,860,349 L4H probably damaging Het
Tax1bp1 C T 6: 52,766,051 Q808* probably null Het
Tnfrsf11a T C 1: 105,827,237 Y345H probably damaging Het
Trpa1 A G 1: 14,884,116 L853P probably damaging Het
Trpm3 A G 19: 22,978,638 R1155G probably damaging Het
Ube4a T C 9: 44,939,999 E739G probably damaging Het
Zfp433 A C 10: 81,720,212 T182P probably damaging Het
Other mutations in Klk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02691:Klk6 APN 7 43828500 missense probably benign 0.03
R0382:Klk6 UTSW 7 43829245 missense probably benign 0.03
R0453:Klk6 UTSW 7 43828539 missense probably damaging 1.00
R1479:Klk6 UTSW 7 43831634 missense probably benign 0.03
R1521:Klk6 UTSW 7 43829275 critical splice donor site probably null
R1772:Klk6 UTSW 7 43829271 nonsense probably null
R1902:Klk6 UTSW 7 43826057 start codon destroyed probably benign 0.03
R4239:Klk6 UTSW 7 43829173 missense probably benign 0.02
R4240:Klk6 UTSW 7 43829173 missense probably benign 0.02
R5182:Klk6 UTSW 7 43828660 missense probably benign 0.16
R5274:Klk6 UTSW 7 43829129 splice site probably null
R6776:Klk6 UTSW 7 43826874 missense probably damaging 1.00
R7411:Klk6 UTSW 7 43826943 missense probably damaging 1.00
R7702:Klk6 UTSW 7 43829265 missense probably damaging 0.98
R8035:Klk6 UTSW 7 43828662 missense probably benign 0.00
Z1088:Klk6 UTSW 7 43828488 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCCATTTGGGAGACAGTGAC -3'
(R):5'- CACGTGTGAGGTGGATTCTC -3'

Sequencing Primer
(F):5'- CAGTGACAAGGAAAGCGATCC -3'
(R):5'- AGTGTCCTCTCAGGCTGAC -3'
Posted On2015-06-12