Incidental Mutation 'R4238:Zfp433'
ID321222
Institutional Source Beutler Lab
Gene Symbol Zfp433
Ensembl Gene ENSMUSG00000096795
Gene Namezinc finger protein 433
Synonyms
MMRRC Submission 041055-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R4238 (G1)
Quality Score220
Status Validated
Chromosome10
Chromosomal Location81704825-81726686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 81720212 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 182 (T182P)
Ref Sequence ENSEMBL: ENSMUSP00000082807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085664] [ENSMUST00000200889] [ENSMUST00000201819]
Predicted Effect probably damaging
Transcript: ENSMUST00000085664
AA Change: T182P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082807
Gene: ENSMUSG00000096795
AA Change: T182P

DomainStartEndE-ValueType
KRAB 3 65 2.34e-15 SMART
ZnF_C2H2 105 127 1.18e-2 SMART
ZnF_C2H2 133 155 2.43e-4 SMART
ZnF_C2H2 161 183 1.6e-4 SMART
ZnF_C2H2 189 211 2.09e-3 SMART
ZnF_C2H2 217 239 1.26e-2 SMART
ZnF_C2H2 245 267 3.69e-4 SMART
ZnF_C2H2 273 295 4.87e-4 SMART
ZnF_C2H2 301 323 8.34e-3 SMART
ZnF_C2H2 329 351 8.34e-3 SMART
ZnF_C2H2 357 379 3.78e-1 SMART
ZnF_C2H2 385 407 2.36e-2 SMART
ZnF_C2H2 413 435 1.69e-3 SMART
ZnF_C2H2 441 463 5.9e-3 SMART
ZnF_C2H2 469 491 2.99e-4 SMART
ZnF_C2H2 497 519 8.94e-3 SMART
ZnF_C2H2 525 547 1.6e-4 SMART
ZnF_C2H2 553 575 5.21e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200889
AA Change: T183P

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000144123
Gene: ENSMUSG00000096795
AA Change: T183P

DomainStartEndE-ValueType
KRAB 4 66 9.8e-18 SMART
ZnF_C2H2 106 128 5.1e-5 SMART
ZnF_C2H2 134 156 1e-6 SMART
ZnF_C2H2 162 184 7.1e-7 SMART
ZnF_C2H2 190 212 8.8e-6 SMART
ZnF_C2H2 218 240 5.4e-5 SMART
ZnF_C2H2 246 268 1.6e-6 SMART
ZnF_C2H2 274 296 2e-6 SMART
ZnF_C2H2 302 324 3.7e-5 SMART
ZnF_C2H2 330 352 3.7e-5 SMART
ZnF_C2H2 358 380 1.6e-3 SMART
ZnF_C2H2 386 408 1e-4 SMART
ZnF_C2H2 414 436 7.4e-6 SMART
ZnF_C2H2 442 464 2.6e-5 SMART
ZnF_C2H2 470 492 1.3e-6 SMART
ZnF_C2H2 498 520 3.9e-5 SMART
ZnF_C2H2 526 548 7e-7 SMART
ZnF_C2H2 554 576 2.3e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201114
Predicted Effect possibly damaging
Transcript: ENSMUST00000201819
AA Change: T151P

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144100
Gene: ENSMUSG00000096795
AA Change: T151P

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-17 BLAST
ZnF_C2H2 74 96 5.1e-5 SMART
ZnF_C2H2 102 124 1e-6 SMART
ZnF_C2H2 130 152 7.1e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219225
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik C T 13: 119,466,942 P93S probably benign Het
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
Aar2 A G 2: 156,551,144 E151G possibly damaging Het
Cacna2d4 A G 6: 119,240,708 D125G probably null Het
Cdc20 C T 4: 118,433,060 R468Q probably damaging Het
Cers3 T C 7: 66,773,676 F87S probably damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Cndp1 G T 18: 84,618,217 H391N probably benign Het
Cpz T C 5: 35,502,474 D609G probably benign Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fam186a T C 15: 99,943,642 I1574V probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Gpr158 G T 2: 21,368,551 C99F probably damaging Het
Gtf2h1 C T 7: 46,805,065 A157V probably benign Het
Hexb T C 13: 97,176,751 probably benign Het
Ighv3-4 A T 12: 114,253,913 D19E probably benign Het
Igkv12-44 A G 6: 69,814,884 S32P probably benign Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Lin54 G A 5: 100,475,744 S78L possibly damaging Het
Lzts1 G T 8: 69,135,927 A459E possibly damaging Het
Mlf1 G A 3: 67,384,577 S25N probably benign Het
Mrgprx2 C A 7: 48,482,990 V27L probably benign Het
Myof T A 19: 37,923,008 R1505* probably null Het
Olfr727 T C 14: 50,127,432 V285A probably benign Het
Otud7a A G 7: 63,650,954 D47G probably damaging Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prc1 G A 7: 80,311,216 probably benign Het
Psg20 A T 7: 18,684,509 V111D probably damaging Het
Scamp3 G A 3: 89,181,927 probably null Het
Simc1 C G 13: 54,526,260 S807* probably null Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Snrpa A T 7: 27,192,868 probably null Het
Sval2 T A 6: 41,860,349 L4H probably damaging Het
Tax1bp1 C T 6: 52,766,051 Q808* probably null Het
Tnfrsf11a T C 1: 105,827,237 Y345H probably damaging Het
Trpa1 A G 1: 14,884,116 L853P probably damaging Het
Trpm3 A G 19: 22,978,638 R1155G probably damaging Het
Ube4a T C 9: 44,939,999 E739G probably damaging Het
Other mutations in Zfp433
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5574:Zfp433 UTSW 10 81719291 nonsense probably null
R6341:Zfp433 UTSW 10 81720123 missense probably damaging 0.99
R6480:Zfp433 UTSW 10 81720244 missense possibly damaging 0.73
R6681:Zfp433 UTSW 10 81720888 missense probably damaging 1.00
R7142:Zfp433 UTSW 10 81720206 nonsense probably null
R7382:Zfp433 UTSW 10 81720825 missense probably benign 0.11
R8058:Zfp433 UTSW 10 81720290 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACCTGTGTGTATGCAGTG -3'
(R):5'- TAAGGTTTCTCTCCAGTGTGAGT -3'

Sequencing Primer
(F):5'- GTCAATGCAGTAAAGCCTTTGC -3'
(R):5'- TCTCTCCAGTGTGAGTTCTTTTG -3'
Posted On2015-06-12