Incidental Mutation 'R4238:Ighv3-4'
ID321226
Institutional Source Beutler Lab
Gene Symbol Ighv3-4
Ensembl Gene ENSMUSG00000103939
Gene Nameimmunoglobulin heavy variable V3-4
Synonyms
MMRRC Submission 041055-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R4238 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location114253617-114254051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114253913 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 19 (D19E)
Ref Sequence ENSEMBL: ENSMUSP00000141962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000193408]
Predicted Effect probably benign
Transcript: ENSMUST00000193408
AA Change: D19E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141962
Gene: ENSMUSG00000103939
AA Change: D19E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGv 35 117 1.2e-29 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik C T 13: 119,466,942 P93S probably benign Het
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
Aar2 A G 2: 156,551,144 E151G possibly damaging Het
Cacna2d4 A G 6: 119,240,708 D125G probably null Het
Cdc20 C T 4: 118,433,060 R468Q probably damaging Het
Cers3 T C 7: 66,773,676 F87S probably damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Cndp1 G T 18: 84,618,217 H391N probably benign Het
Cpz T C 5: 35,502,474 D609G probably benign Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fam186a T C 15: 99,943,642 I1574V probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Gpr158 G T 2: 21,368,551 C99F probably damaging Het
Gtf2h1 C T 7: 46,805,065 A157V probably benign Het
Hexb T C 13: 97,176,751 probably benign Het
Igkv12-44 A G 6: 69,814,884 S32P probably benign Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Lin54 G A 5: 100,475,744 S78L possibly damaging Het
Lzts1 G T 8: 69,135,927 A459E possibly damaging Het
Mlf1 G A 3: 67,384,577 S25N probably benign Het
Mrgprx2 C A 7: 48,482,990 V27L probably benign Het
Myof T A 19: 37,923,008 R1505* probably null Het
Olfr727 T C 14: 50,127,432 V285A probably benign Het
Otud7a A G 7: 63,650,954 D47G probably damaging Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prc1 G A 7: 80,311,216 probably benign Het
Psg20 A T 7: 18,684,509 V111D probably damaging Het
Scamp3 G A 3: 89,181,927 probably null Het
Simc1 C G 13: 54,526,260 S807* probably null Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Snrpa A T 7: 27,192,868 probably null Het
Sval2 T A 6: 41,860,349 L4H probably damaging Het
Tax1bp1 C T 6: 52,766,051 Q808* probably null Het
Tnfrsf11a T C 1: 105,827,237 Y345H probably damaging Het
Trpa1 A G 1: 14,884,116 L853P probably damaging Het
Trpm3 A G 19: 22,978,638 R1155G probably damaging Het
Ube4a T C 9: 44,939,999 E739G probably damaging Het
Zfp433 A C 10: 81,720,212 T182P probably damaging Het
Other mutations in Ighv3-4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3907:Ighv3-4 UTSW 12 114253918 missense probably damaging 1.00
R3957:Ighv3-4 UTSW 12 114253680 missense probably damaging 1.00
R4237:Ighv3-4 UTSW 12 114253913 missense probably benign 0.00
R4239:Ighv3-4 UTSW 12 114253913 missense probably benign 0.00
R4355:Ighv3-4 UTSW 12 114253640 missense probably benign 0.01
R5026:Ighv3-4 UTSW 12 114253762 missense probably benign 0.03
R5745:Ighv3-4 UTSW 12 114253768 missense probably benign 0.00
R7068:Ighv3-4 UTSW 12 114253654 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTGCTGTCAGTGCTACCAC -3'
(R):5'- TTAAATCCCCTCCTGGACTGTG -3'

Sequencing Primer
(F):5'- GTGCTACCACTGGAGCTTATGTAC -3'
(R):5'- TCACTGGAGCGTGATCTCTCAAG -3'
Posted On2015-06-12