Incidental Mutation 'R4238:Olfr727'
ID321231
Institutional Source Beutler Lab
Gene Symbol Olfr727
Ensembl Gene ENSMUSG00000059488
Gene Nameolfactory receptor 727
SynonymsGA_x6K02T2PMLR-5817082-5818056, MOR246-2
MMRRC Submission 041055-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R4238 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50123186-50128746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50127432 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 285 (V285A)
Ref Sequence ENSEMBL: ENSMUSP00000149886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079142] [ENSMUST00000215317]
Predicted Effect probably benign
Transcript: ENSMUST00000079142
AA Change: V285A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078145
Gene: ENSMUSG00000059488
AA Change: V285A

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 8.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 36 290 1.5e-7 PFAM
Pfam:7tm_1 41 287 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205947
Predicted Effect probably benign
Transcript: ENSMUST00000215317
AA Change: V285A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1134 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik C T 13: 119,466,942 P93S probably benign Het
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
Aar2 A G 2: 156,551,144 E151G possibly damaging Het
Cacna2d4 A G 6: 119,240,708 D125G probably null Het
Cdc20 C T 4: 118,433,060 R468Q probably damaging Het
Cers3 T C 7: 66,773,676 F87S probably damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Cndp1 G T 18: 84,618,217 H391N probably benign Het
Cpz T C 5: 35,502,474 D609G probably benign Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fam186a T C 15: 99,943,642 I1574V probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Gpr158 G T 2: 21,368,551 C99F probably damaging Het
Gtf2h1 C T 7: 46,805,065 A157V probably benign Het
Hexb T C 13: 97,176,751 probably benign Het
Ighv3-4 A T 12: 114,253,913 D19E probably benign Het
Igkv12-44 A G 6: 69,814,884 S32P probably benign Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Lin54 G A 5: 100,475,744 S78L possibly damaging Het
Lzts1 G T 8: 69,135,927 A459E possibly damaging Het
Mlf1 G A 3: 67,384,577 S25N probably benign Het
Mrgprx2 C A 7: 48,482,990 V27L probably benign Het
Myof T A 19: 37,923,008 R1505* probably null Het
Otud7a A G 7: 63,650,954 D47G probably damaging Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prc1 G A 7: 80,311,216 probably benign Het
Psg20 A T 7: 18,684,509 V111D probably damaging Het
Scamp3 G A 3: 89,181,927 probably null Het
Simc1 C G 13: 54,526,260 S807* probably null Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Snrpa A T 7: 27,192,868 probably null Het
Sval2 T A 6: 41,860,349 L4H probably damaging Het
Tax1bp1 C T 6: 52,766,051 Q808* probably null Het
Tnfrsf11a T C 1: 105,827,237 Y345H probably damaging Het
Trpa1 A G 1: 14,884,116 L853P probably damaging Het
Trpm3 A G 19: 22,978,638 R1155G probably damaging Het
Ube4a T C 9: 44,939,999 E739G probably damaging Het
Zfp433 A C 10: 81,720,212 T182P probably damaging Het
Other mutations in Olfr727
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Olfr727 APN 14 50126757 missense probably damaging 1.00
IGL01306:Olfr727 APN 14 50126582 missense probably benign 0.00
ANU23:Olfr727 UTSW 14 50126582 missense probably benign 0.00
R0498:Olfr727 UTSW 14 50127293 missense probably damaging 1.00
R0574:Olfr727 UTSW 14 50126682 missense probably damaging 1.00
R1201:Olfr727 UTSW 14 50127356 missense probably damaging 1.00
R2112:Olfr727 UTSW 14 50126623 missense probably damaging 1.00
R2435:Olfr727 UTSW 14 50126754 missense probably damaging 1.00
R4611:Olfr727 UTSW 14 50127073 missense probably benign 0.12
R4663:Olfr727 UTSW 14 50127482 missense probably benign 0.00
R4672:Olfr727 UTSW 14 50127257 missense probably benign 0.02
R5022:Olfr727 UTSW 14 50127012 missense possibly damaging 0.78
R5062:Olfr727 UTSW 14 50127437 missense probably damaging 1.00
R5924:Olfr727 UTSW 14 50126682 missense probably damaging 1.00
R6702:Olfr727 UTSW 14 50127231 missense probably damaging 1.00
R6703:Olfr727 UTSW 14 50127231 missense probably damaging 1.00
R7497:Olfr727 UTSW 14 50127495 missense probably benign 0.20
R7615:Olfr727 UTSW 14 50126989 missense probably benign 0.07
R7798:Olfr727 UTSW 14 50127438 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGTTCCTCTGCTAGCATGG -3'
(R):5'- TAGTAAGCCTTTAAACAGCCCC -3'

Sequencing Primer
(F):5'- TCTGCTAGCATGGCCAAG -3'
(R):5'- ACTAACTTTAGAAGTAAAGGCACTTC -3'
Posted On2015-06-12