Incidental Mutation 'R4239:Gm6871'
ID321254
Institutional Source Beutler Lab
Gene Symbol Gm6871
Ensembl Gene ENSMUSG00000090744
Gene Namepredicted gene 6871
Synonyms
MMRRC Submission 041056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4239 (G1)
Quality Score178
Status Validated
Chromosome7
Chromosomal Location41545674-41573662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 41545780 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 511 (T511K)
Ref Sequence ENSEMBL: ENSMUSP00000105843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073410] [ENSMUST00000110214] [ENSMUST00000164677]
Predicted Effect probably benign
Transcript: ENSMUST00000073410
AA Change: T404K

PolyPhen 2 Score 0.248 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000073117
Gene: ENSMUSG00000090744
AA Change: T404K

DomainStartEndE-ValueType
KRAB 4 64 1.19e-16 SMART
ZnF_C2H2 131 153 3.44e-4 SMART
ZnF_C2H2 159 181 5.99e-4 SMART
ZnF_C2H2 187 209 3.34e-2 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 243 265 1.28e-3 SMART
ZnF_C2H2 271 293 3.69e-4 SMART
ZnF_C2H2 299 321 1.36e-2 SMART
ZnF_C2H2 327 349 3.21e-4 SMART
ZnF_C2H2 355 377 2.61e-4 SMART
ZnF_C2H2 383 405 3.16e-3 SMART
ZnF_C2H2 411 433 5.14e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110214
AA Change: T511K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105843
Gene: ENSMUSG00000090744
AA Change: T511K

DomainStartEndE-ValueType
KRAB 111 171 1.19e-16 SMART
ZnF_C2H2 238 260 3.44e-4 SMART
ZnF_C2H2 266 288 5.99e-4 SMART
ZnF_C2H2 294 316 3.34e-2 SMART
ZnF_C2H2 322 344 5.99e-4 SMART
ZnF_C2H2 350 372 1.28e-3 SMART
ZnF_C2H2 378 400 3.69e-4 SMART
ZnF_C2H2 406 428 1.36e-2 SMART
ZnF_C2H2 434 456 3.21e-4 SMART
ZnF_C2H2 462 484 2.61e-4 SMART
ZnF_C2H2 490 512 3.16e-3 SMART
ZnF_C2H2 518 540 5.14e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164677
SMART Domains Protein: ENSMUSP00000131240
Gene: ENSMUSG00000090744

DomainStartEndE-ValueType
internal_repeat_1 21 67 6.62e-7 PROSPERO
internal_repeat_1 105 151 6.62e-7 PROSPERO
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (55/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
Alpk2 T A 18: 65,300,141 I1765F probably damaging Het
Ano5 T A 7: 51,587,666 I696N probably damaging Het
Areg A T 5: 91,143,516 N106I probably damaging Het
Atad2b A G 12: 4,985,710 N759D probably benign Het
B4galnt4 T C 7: 141,061,326 L18P probably damaging Het
Boc T C 16: 44,491,884 D605G probably damaging Het
Cfap46 G T 7: 139,666,287 Q387K possibly damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Clip2 A G 5: 134,535,197 probably benign Het
Cog4 T C 8: 110,858,612 I303T probably damaging Het
Col18a1 C T 10: 77,096,167 V363I unknown Het
Crip3 A T 17: 46,431,230 K184* probably null Het
Ddi1 A G 9: 6,265,799 M190T probably benign Het
Dnah3 G A 7: 120,029,025 Q1459* probably null Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Ehhadh T G 16: 21,762,688 D518A probably damaging Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fbxl3 G A 14: 103,089,418 S176L probably damaging Het
Gm1979 T C 5: 26,001,121 T154A probably benign Het
Gtf2h1 C T 7: 46,805,065 A157V probably benign Het
Hexb T C 13: 97,176,751 probably benign Het
Ifi214 A T 1: 173,524,943 S307T possibly damaging Het
Ighv3-4 A T 12: 114,253,913 D19E probably benign Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Large2 A G 2: 92,366,605 probably benign Het
Myo5c T C 9: 75,283,942 I1086T probably benign Het
Nes C A 3: 87,979,359 P1598T probably damaging Het
Olfr1002 T A 2: 85,648,303 Q6L probably damaging Het
Olfr539 A G 7: 140,667,583 N99D probably benign Het
Olfr583 T C 7: 103,051,796 V166A probably benign Het
Otud7a A G 7: 63,650,954 D47G probably damaging Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Plcb1 A T 2: 135,344,158 I682F probably damaging Het
Plcz1 T A 6: 140,040,618 probably null Het
Prl7a1 T A 13: 27,637,566 Q129L possibly damaging Het
Prrt4 T C 6: 29,170,164 Y763C probably damaging Het
Psma7 T C 2: 180,039,511 probably benign Het
Serpinb6b G C 13: 32,972,263 C112S probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Slc35f5 G A 1: 125,572,474 A242T possibly damaging Het
Speer4b T C 5: 27,501,313 R19G probably benign Het
Trank1 A G 9: 111,367,035 I1376V probably benign Het
Trbv12-2 A G 6: 41,118,897 N12D probably benign Het
Uba7 T C 9: 107,976,802 probably null Het
Upf3a A G 8: 13,796,591 R324G probably benign Het
Usp46 T G 5: 74,032,267 probably benign Het
Vmn2r14 T G 5: 109,216,411 probably null Het
Wbp2 G A 11: 116,080,547 probably benign Het
Wdpcp T A 11: 21,695,269 N232K probably damaging Het
Wdpcp T A 11: 21,695,271 M233K probably benign Het
Zfp157 A G 5: 138,447,541 I53V probably damaging Het
Other mutations in Gm6871
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Gm6871 APN 7 41546421 missense possibly damaging 0.67
R0419:Gm6871 UTSW 7 41573445 missense probably benign 0.00
R1005:Gm6871 UTSW 7 41546258 missense probably damaging 1.00
R1544:Gm6871 UTSW 7 41546090 unclassified probably null
R1553:Gm6871 UTSW 7 41546398 missense probably benign 0.00
R1674:Gm6871 UTSW 7 41573635 missense possibly damaging 0.46
R1710:Gm6871 UTSW 7 41546477 missense probably damaging 1.00
R1743:Gm6871 UTSW 7 41546452 missense probably damaging 0.98
R1777:Gm6871 UTSW 7 41545719 missense probably benign 0.23
R1844:Gm6871 UTSW 7 41573468 missense probably benign 0.03
R2508:Gm6871 UTSW 7 41547990 missense probably benign 0.11
R2966:Gm6871 UTSW 7 41573440 missense probably benign 0.07
R3155:Gm6871 UTSW 7 41573655 missense probably benign 0.03
R3156:Gm6871 UTSW 7 41573655 missense probably benign 0.03
R3967:Gm6871 UTSW 7 41546724 missense probably damaging 0.99
R4156:Gm6871 UTSW 7 41546086 missense probably damaging 0.96
R4238:Gm6871 UTSW 7 41545780 missense probably damaging 1.00
R4240:Gm6871 UTSW 7 41545780 missense probably damaging 1.00
R4731:Gm6871 UTSW 7 41546749 missense probably benign 0.01
R4732:Gm6871 UTSW 7 41546749 missense probably benign 0.01
R4733:Gm6871 UTSW 7 41546749 missense probably benign 0.01
R4910:Gm6871 UTSW 7 41573592 missense probably benign 0.03
R5269:Gm6871 UTSW 7 41548101 missense probably damaging 0.99
R5371:Gm6871 UTSW 7 41573568 missense probably benign 0.07
R6222:Gm6871 UTSW 7 41546582 missense probably damaging 0.99
R6975:Gm6871 UTSW 7 41546778 synonymous silent
R8006:Gm6871 UTSW 7 41545682 missense probably benign 0.10
Z1176:Gm6871 UTSW 7 41546413 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGATGCGCAAAAGCTTTACC -3'
(R):5'- GCCTTTGCACAACACAATAGTCTC -3'

Sequencing Primer
(F):5'- GATGCGCAAAAGCTTTACCACATTTC -3'
(R):5'- TGCACAACACAATAGTCTCCAAATAC -3'
Posted On2015-06-12