Incidental Mutation 'R4239:Cfap46'
ID 321263
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Name cilia and flagella associated protein 46
Synonyms 9330101J02Rik
MMRRC Submission 041056-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4239 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 139600951-139683817 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 139666287 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 387 (Q387K)
Ref Sequence ENSEMBL: ENSMUSP00000120186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000140820]
AlphaFold E9Q2C0
Predicted Effect possibly damaging
Transcript: ENSMUST00000129990
AA Change: Q387K

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: Q387K

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000140820
AA Change: Q387K

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571
AA Change: Q387K

DomainStartEndE-ValueType
Blast:TPR 175 208 5e-11 BLAST
Blast:TPR 426 459 8e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156116
Meta Mutation Damage Score 0.1184 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (55/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
Alpk2 T A 18: 65,300,141 I1765F probably damaging Het
Ano5 T A 7: 51,587,666 I696N probably damaging Het
Areg A T 5: 91,143,516 N106I probably damaging Het
Atad2b A G 12: 4,985,710 N759D probably benign Het
B4galnt4 T C 7: 141,061,326 L18P probably damaging Het
Boc T C 16: 44,491,884 D605G probably damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Clip2 A G 5: 134,535,197 probably benign Het
Cog4 T C 8: 110,858,612 I303T probably damaging Het
Col18a1 C T 10: 77,096,167 V363I unknown Het
Crip3 A T 17: 46,431,230 K184* probably null Het
Ddi1 A G 9: 6,265,799 M190T probably benign Het
Dnah3 G A 7: 120,029,025 Q1459* probably null Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Ehhadh T G 16: 21,762,688 D518A probably damaging Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fbxl3 G A 14: 103,089,418 S176L probably damaging Het
Gm1979 T C 5: 26,001,121 T154A probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Gtf2h1 C T 7: 46,805,065 A157V probably benign Het
Hexb T C 13: 97,176,751 probably benign Het
Ifi214 A T 1: 173,524,943 S307T possibly damaging Het
Ighv3-4 A T 12: 114,253,913 D19E probably benign Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Large2 A G 2: 92,366,605 probably benign Het
Myo5c T C 9: 75,283,942 I1086T probably benign Het
Nes C A 3: 87,979,359 P1598T probably damaging Het
Olfr1002 T A 2: 85,648,303 Q6L probably damaging Het
Olfr539 A G 7: 140,667,583 N99D probably benign Het
Olfr583 T C 7: 103,051,796 V166A probably benign Het
Otud7a A G 7: 63,650,954 D47G probably damaging Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Plcb1 A T 2: 135,344,158 I682F probably damaging Het
Plcz1 T A 6: 140,040,618 probably null Het
Prl7a1 T A 13: 27,637,566 Q129L possibly damaging Het
Prrt4 T C 6: 29,170,164 Y763C probably damaging Het
Psma7 T C 2: 180,039,511 probably benign Het
Serpinb6b G C 13: 32,972,263 C112S probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Slc35f5 G A 1: 125,572,474 A242T possibly damaging Het
Speer4b T C 5: 27,501,313 R19G probably benign Het
Trank1 A G 9: 111,367,035 I1376V probably benign Het
Trbv12-2 A G 6: 41,118,897 N12D probably benign Het
Uba7 T C 9: 107,976,802 probably null Het
Upf3a A G 8: 13,796,591 R324G probably benign Het
Usp46 T G 5: 74,032,267 probably benign Het
Vmn2r14 T G 5: 109,216,411 probably null Het
Wbp2 G A 11: 116,080,547 probably benign Het
Wdpcp T A 11: 21,695,269 N232K probably damaging Het
Wdpcp T A 11: 21,695,271 M233K probably benign Het
Zfp157 A G 5: 138,447,541 I53V probably damaging Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4595:Cfap46 UTSW 7 139652404 missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139650942 missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139680831 missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139614405 critical splice donor site probably null
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139642561 utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139652498 missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7327:Cfap46 UTSW 7 139635146 splice site probably null
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
R7495:Cfap46 UTSW 7 139603196 critical splice donor site probably null
R7618:Cfap46 UTSW 7 139603239 missense
R7623:Cfap46 UTSW 7 139618350 missense unknown
R7765:Cfap46 UTSW 7 139651564 missense
R7971:Cfap46 UTSW 7 139635127 missense unknown
R8211:Cfap46 UTSW 7 139633304 missense unknown
R8306:Cfap46 UTSW 7 139656580 missense
R8354:Cfap46 UTSW 7 139653498 missense probably benign 0.03
R8365:Cfap46 UTSW 7 139683084 nonsense probably null
R8447:Cfap46 UTSW 7 139680986 missense possibly damaging 0.90
R8715:Cfap46 UTSW 7 139605644 missense
R8805:Cfap46 UTSW 7 139632063 missense unknown
R8830:Cfap46 UTSW 7 139615649 missense unknown
R8912:Cfap46 UTSW 7 139680181 intron probably benign
R8920:Cfap46 UTSW 7 139652526 missense
R8977:Cfap46 UTSW 7 139679933 missense probably benign 0.01
R9048:Cfap46 UTSW 7 139627343 missense unknown
R9224:Cfap46 UTSW 7 139678500 nonsense probably null
R9252:Cfap46 UTSW 7 139618249 missense unknown
R9276:Cfap46 UTSW 7 139621291 missense unknown
R9301:Cfap46 UTSW 7 139642545 missense
R9391:Cfap46 UTSW 7 139618111 missense unknown
R9402:Cfap46 UTSW 7 139635949 missense unknown
R9443:Cfap46 UTSW 7 139615107 missense
RF023:Cfap46 UTSW 7 139638918
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Z1176:Cfap46 UTSW 7 139639548 missense
Z1177:Cfap46 UTSW 7 139601267 missense unknown
Z1177:Cfap46 UTSW 7 139630626 missense unknown
Predicted Primers PCR Primer
(F):5'- AAACTGGGCTCGTGTACCAG -3'
(R):5'- GCTCTTCTAGGTGGTGACCATG -3'

Sequencing Primer
(F):5'- GTGTACCAGTCTACCGCACAG -3'
(R):5'- ATGGTTGGCATCCCATCCTCG -3'
Posted On 2015-06-12