Incidental Mutation 'R4239:Olfr539'
ID 321264
Institutional Source Beutler Lab
Gene Symbol Olfr539
Ensembl Gene ENSMUSG00000059136
Gene Name olfactory receptor 539
Synonyms MOR253-4, GA_x6K02T2PBJ9-42813436-42814368
MMRRC Submission 041056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R4239 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 140659930-140678580 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 140667583 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 99 (N99D)
Ref Sequence ENSEMBL: ENSMUSP00000077990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078967] [ENSMUST00000210973] [ENSMUST00000218865]
AlphaFold Q8VGL9
Predicted Effect probably benign
Transcript: ENSMUST00000078967
AA Change: N99D

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000077990
Gene: ENSMUSG00000059136
AA Change: N99D

DomainStartEndE-ValueType
Pfam:7tm_4 40 316 6.5e-50 PFAM
Pfam:7tm_1 50 299 4.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210973
AA Change: N92D
Predicted Effect probably benign
Transcript: ENSMUST00000218865
AA Change: N92D

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219853
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (55/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
Alpk2 T A 18: 65,300,141 I1765F probably damaging Het
Ano5 T A 7: 51,587,666 I696N probably damaging Het
Areg A T 5: 91,143,516 N106I probably damaging Het
Atad2b A G 12: 4,985,710 N759D probably benign Het
B4galnt4 T C 7: 141,061,326 L18P probably damaging Het
Boc T C 16: 44,491,884 D605G probably damaging Het
Cfap46 G T 7: 139,666,287 Q387K possibly damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Clip2 A G 5: 134,535,197 probably benign Het
Cog4 T C 8: 110,858,612 I303T probably damaging Het
Col18a1 C T 10: 77,096,167 V363I unknown Het
Crip3 A T 17: 46,431,230 K184* probably null Het
Ddi1 A G 9: 6,265,799 M190T probably benign Het
Dnah3 G A 7: 120,029,025 Q1459* probably null Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Ehhadh T G 16: 21,762,688 D518A probably damaging Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fbxl3 G A 14: 103,089,418 S176L probably damaging Het
Gm1979 T C 5: 26,001,121 T154A probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Gtf2h1 C T 7: 46,805,065 A157V probably benign Het
Hexb T C 13: 97,176,751 probably benign Het
Ifi214 A T 1: 173,524,943 S307T possibly damaging Het
Ighv3-4 A T 12: 114,253,913 D19E probably benign Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Large2 A G 2: 92,366,605 probably benign Het
Myo5c T C 9: 75,283,942 I1086T probably benign Het
Nes C A 3: 87,979,359 P1598T probably damaging Het
Olfr1002 T A 2: 85,648,303 Q6L probably damaging Het
Olfr583 T C 7: 103,051,796 V166A probably benign Het
Otud7a A G 7: 63,650,954 D47G probably damaging Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Plcb1 A T 2: 135,344,158 I682F probably damaging Het
Plcz1 T A 6: 140,040,618 probably null Het
Prl7a1 T A 13: 27,637,566 Q129L possibly damaging Het
Prrt4 T C 6: 29,170,164 Y763C probably damaging Het
Psma7 T C 2: 180,039,511 probably benign Het
Serpinb6b G C 13: 32,972,263 C112S probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Slc35f5 G A 1: 125,572,474 A242T possibly damaging Het
Speer4b T C 5: 27,501,313 R19G probably benign Het
Trank1 A G 9: 111,367,035 I1376V probably benign Het
Trbv12-2 A G 6: 41,118,897 N12D probably benign Het
Uba7 T C 9: 107,976,802 probably null Het
Upf3a A G 8: 13,796,591 R324G probably benign Het
Usp46 T G 5: 74,032,267 probably benign Het
Vmn2r14 T G 5: 109,216,411 probably null Het
Wbp2 G A 11: 116,080,547 probably benign Het
Wdpcp T A 11: 21,695,269 N232K probably damaging Het
Wdpcp T A 11: 21,695,271 M233K probably benign Het
Zfp157 A G 5: 138,447,541 I53V probably damaging Het
Other mutations in Olfr539
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr539 APN 7 140667941 missense probably benign 0.01
IGL01610:Olfr539 APN 7 140667671 missense probably damaging 1.00
IGL02959:Olfr539 APN 7 140667550 missense probably damaging 1.00
IGL03406:Olfr539 APN 7 140667511 missense probably damaging 1.00
R0671:Olfr539 UTSW 7 140667677 missense probably damaging 1.00
R1771:Olfr539 UTSW 7 140668135 missense probably benign
R1934:Olfr539 UTSW 7 140668038 nonsense probably null
R1985:Olfr539 UTSW 7 140667821 missense probably damaging 1.00
R2962:Olfr539 UTSW 7 140667949 missense probably benign
R4240:Olfr539 UTSW 7 140667583 missense probably benign 0.07
R4360:Olfr539 UTSW 7 140667817 missense probably damaging 0.98
R4841:Olfr539 UTSW 7 140667589 missense probably damaging 1.00
R4842:Olfr539 UTSW 7 140667589 missense probably damaging 1.00
R4851:Olfr539 UTSW 7 140667313 missense probably benign
R5325:Olfr539 UTSW 7 140667792 missense probably benign 0.33
R5766:Olfr539 UTSW 7 140667353 missense probably benign 0.02
R6363:Olfr539 UTSW 7 140668082 missense possibly damaging 0.93
R6836:Olfr539 UTSW 7 140668180 missense possibly damaging 0.86
R7777:Olfr539 UTSW 7 140667941 missense probably benign 0.01
R7920:Olfr539 UTSW 7 140667901 missense possibly damaging 0.92
R8134:Olfr539 UTSW 7 140667767 missense possibly damaging 0.90
R8712:Olfr539 UTSW 7 140668139 missense possibly damaging 0.89
R9095:Olfr539 UTSW 7 140667900 missense probably damaging 1.00
R9158:Olfr539 UTSW 7 140667634 missense possibly damaging 0.76
R9603:Olfr539 UTSW 7 140667881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGTTCCTGACAGGCTGCTTC -3'
(R):5'- ACATGCATTCACAAGACCGATG -3'

Sequencing Primer
(F):5'- GACAGGCTGCTTCTTGTCC -3'
(R):5'- GCATTCACAAGACCGATGAACCATAC -3'
Posted On 2015-06-12