Incidental Mutation 'R4239:Serpinb6b'
ID 321281
Institutional Source Beutler Lab
Gene Symbol Serpinb6b
Ensembl Gene ENSMUSG00000042842
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6b
Synonyms NK13, ovalbumin, Spi12
MMRRC Submission 041056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock # R4239 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 32965209-32979067 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 32972263 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 112 (C112S)
Ref Sequence ENSEMBL: ENSMUSP00000017184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017184] [ENSMUST00000110293] [ENSMUST00000164541]
AlphaFold O08804
Predicted Effect probably damaging
Transcript: ENSMUST00000017184
AA Change: C112S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000017184
Gene: ENSMUSG00000042842
AA Change: C112S

DomainStartEndE-ValueType
SERPIN 13 208 1.22e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110293
AA Change: C112S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105922
Gene: ENSMUSG00000042842
AA Change: C112S

DomainStartEndE-ValueType
SERPIN 13 377 1.99e-174 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222967
Meta Mutation Damage Score 0.4647 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (55/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
Alpk2 T A 18: 65,300,141 I1765F probably damaging Het
Ano5 T A 7: 51,587,666 I696N probably damaging Het
Areg A T 5: 91,143,516 N106I probably damaging Het
Atad2b A G 12: 4,985,710 N759D probably benign Het
B4galnt4 T C 7: 141,061,326 L18P probably damaging Het
Boc T C 16: 44,491,884 D605G probably damaging Het
Cfap46 G T 7: 139,666,287 Q387K possibly damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Clip2 A G 5: 134,535,197 probably benign Het
Cog4 T C 8: 110,858,612 I303T probably damaging Het
Col18a1 C T 10: 77,096,167 V363I unknown Het
Crip3 A T 17: 46,431,230 K184* probably null Het
Ddi1 A G 9: 6,265,799 M190T probably benign Het
Dnah3 G A 7: 120,029,025 Q1459* probably null Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Ehhadh T G 16: 21,762,688 D518A probably damaging Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fbxl3 G A 14: 103,089,418 S176L probably damaging Het
Gm1979 T C 5: 26,001,121 T154A probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Gtf2h1 C T 7: 46,805,065 A157V probably benign Het
Hexb T C 13: 97,176,751 probably benign Het
Ifi214 A T 1: 173,524,943 S307T possibly damaging Het
Ighv3-4 A T 12: 114,253,913 D19E probably benign Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Large2 A G 2: 92,366,605 probably benign Het
Myo5c T C 9: 75,283,942 I1086T probably benign Het
Nes C A 3: 87,979,359 P1598T probably damaging Het
Olfr1002 T A 2: 85,648,303 Q6L probably damaging Het
Olfr539 A G 7: 140,667,583 N99D probably benign Het
Olfr583 T C 7: 103,051,796 V166A probably benign Het
Otud7a A G 7: 63,650,954 D47G probably damaging Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Plcb1 A T 2: 135,344,158 I682F probably damaging Het
Plcz1 T A 6: 140,040,618 probably null Het
Prl7a1 T A 13: 27,637,566 Q129L possibly damaging Het
Prrt4 T C 6: 29,170,164 Y763C probably damaging Het
Psma7 T C 2: 180,039,511 probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Slc35f5 G A 1: 125,572,474 A242T possibly damaging Het
Speer4b T C 5: 27,501,313 R19G probably benign Het
Trank1 A G 9: 111,367,035 I1376V probably benign Het
Trbv12-2 A G 6: 41,118,897 N12D probably benign Het
Uba7 T C 9: 107,976,802 probably null Het
Upf3a A G 8: 13,796,591 R324G probably benign Het
Usp46 T G 5: 74,032,267 probably benign Het
Vmn2r14 T G 5: 109,216,411 probably null Het
Wbp2 G A 11: 116,080,547 probably benign Het
Wdpcp T A 11: 21,695,269 N232K probably damaging Het
Wdpcp T A 11: 21,695,271 M233K probably benign Het
Zfp157 A G 5: 138,447,541 I53V probably damaging Het
Other mutations in Serpinb6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Serpinb6b APN 13 32971546 missense probably benign 0.01
IGL01077:Serpinb6b APN 13 32978066 missense possibly damaging 0.68
IGL01553:Serpinb6b APN 13 32974948 missense probably damaging 1.00
IGL02981:Serpinb6b APN 13 32971606 missense probably benign 0.34
R0308:Serpinb6b UTSW 13 32978237 missense probably benign 0.09
R1568:Serpinb6b UTSW 13 32974912 missense probably damaging 1.00
R1692:Serpinb6b UTSW 13 32974995 missense probably damaging 1.00
R1763:Serpinb6b UTSW 13 32978058 missense probably damaging 1.00
R1917:Serpinb6b UTSW 13 32978240 missense probably benign
R1918:Serpinb6b UTSW 13 32978240 missense probably benign
R1919:Serpinb6b UTSW 13 32978240 missense probably benign
R1920:Serpinb6b UTSW 13 32975008 missense possibly damaging 0.47
R3032:Serpinb6b UTSW 13 32968568 missense possibly damaging 0.78
R5089:Serpinb6b UTSW 13 32978150 missense probably benign
R5503:Serpinb6b UTSW 13 32977659 missense possibly damaging 0.95
R5540:Serpinb6b UTSW 13 32977558 nonsense probably null
R6061:Serpinb6b UTSW 13 32977994 missense probably damaging 0.99
R6253:Serpinb6b UTSW 13 32972272 missense probably damaging 1.00
R7156:Serpinb6b UTSW 13 32971615 missense probably benign 0.09
R7248:Serpinb6b UTSW 13 32977576 missense probably benign 0.23
R7315:Serpinb6b UTSW 13 32972257 missense probably benign 0.41
R7424:Serpinb6b UTSW 13 32968667 missense probably damaging 0.99
R7547:Serpinb6b UTSW 13 32974924 missense probably benign 0.05
R7732:Serpinb6b UTSW 13 32968607 missense probably damaging 1.00
R7770:Serpinb6b UTSW 13 32977529 missense probably benign 0.05
R7802:Serpinb6b UTSW 13 32971596
R8814:Serpinb6b UTSW 13 32978304 missense possibly damaging 0.94
R8966:Serpinb6b UTSW 13 32978052 missense probably damaging 1.00
R8988:Serpinb6b UTSW 13 32978142 missense probably benign 0.45
R9037:Serpinb6b UTSW 13 32978015 nonsense probably null
R9129:Serpinb6b UTSW 13 32978156 small deletion probably benign
R9377:Serpinb6b UTSW 13 32968511 start codon destroyed probably null 1.00
R9415:Serpinb6b UTSW 13 32975019 missense
Predicted Primers PCR Primer
(F):5'- TGGTTGTCTTACCCAACTCAATAAC -3'
(R):5'- TCTCTGAGCATGTTCAAGGCC -3'

Sequencing Primer
(F):5'- GTTTATTATAGATGCCCCCCC -3'
(R):5'- ATGTTCAAGGCCATGGGTCC -3'
Posted On 2015-06-12