Incidental Mutation 'R4239:Alpk2'
ID321288
Institutional Source Beutler Lab
Gene Symbol Alpk2
Ensembl Gene ENSMUSG00000032845
Gene Namealpha-kinase 2
SynonymsHak
MMRRC Submission 041056-MU
Accession Numbers

Genbank: NM_001037294

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4239 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location65265529-65393888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65300141 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1765 (I1765F)
Ref Sequence ENSEMBL: ENSMUSP00000048752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035548] [ENSMUST00000141250]
Predicted Effect probably damaging
Transcript: ENSMUST00000035548
AA Change: I1765F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048752
Gene: ENSMUSG00000032845
AA Change: I1765F

DomainStartEndE-ValueType
IGc2 24 94 9.34e-4 SMART
low complexity region 196 209 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
low complexity region 1337 1353 N/A INTRINSIC
IG 1766 1849 2.27e-2 SMART
Alpha_kinase 1879 2098 3.72e-79 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000141250
AA Change: I1298F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114658
Gene: ENSMUSG00000032845
AA Change: I1298F

DomainStartEndE-ValueType
low complexity region 255 267 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
low complexity region 870 886 N/A INTRINSIC
IG 1299 1382 2.27e-2 SMART
Alpha_kinase 1412 1603 2.45e-56 SMART
Meta Mutation Damage Score 0.1555 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (55/58)
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
Ano5 T A 7: 51,587,666 I696N probably damaging Het
Areg A T 5: 91,143,516 N106I probably damaging Het
Atad2b A G 12: 4,985,710 N759D probably benign Het
B4galnt4 T C 7: 141,061,326 L18P probably damaging Het
Boc T C 16: 44,491,884 D605G probably damaging Het
Cfap46 G T 7: 139,666,287 Q387K possibly damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Clip2 A G 5: 134,535,197 probably benign Het
Cog4 T C 8: 110,858,612 I303T probably damaging Het
Col18a1 C T 10: 77,096,167 V363I unknown Het
Crip3 A T 17: 46,431,230 K184* probably null Het
Ddi1 A G 9: 6,265,799 M190T probably benign Het
Dnah3 G A 7: 120,029,025 Q1459* probably null Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Ehhadh T G 16: 21,762,688 D518A probably damaging Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fbxl3 G A 14: 103,089,418 S176L probably damaging Het
Gm1979 T C 5: 26,001,121 T154A probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Gtf2h1 C T 7: 46,805,065 A157V probably benign Het
Hexb T C 13: 97,176,751 probably benign Het
Ifi214 A T 1: 173,524,943 S307T possibly damaging Het
Ighv3-4 A T 12: 114,253,913 D19E probably benign Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Large2 A G 2: 92,366,605 probably benign Het
Myo5c T C 9: 75,283,942 I1086T probably benign Het
Nes C A 3: 87,979,359 P1598T probably damaging Het
Olfr1002 T A 2: 85,648,303 Q6L probably damaging Het
Olfr539 A G 7: 140,667,583 N99D probably benign Het
Olfr583 T C 7: 103,051,796 V166A probably benign Het
Otud7a A G 7: 63,650,954 D47G probably damaging Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Plcb1 A T 2: 135,344,158 I682F probably damaging Het
Plcz1 T A 6: 140,040,618 probably null Het
Prl7a1 T A 13: 27,637,566 Q129L possibly damaging Het
Prrt4 T C 6: 29,170,164 Y763C probably damaging Het
Psma7 T C 2: 180,039,511 probably benign Het
Serpinb6b G C 13: 32,972,263 C112S probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Slc35f5 G A 1: 125,572,474 A242T possibly damaging Het
Speer4b T C 5: 27,501,313 R19G probably benign Het
Trank1 A G 9: 111,367,035 I1376V probably benign Het
Trbv12-2 A G 6: 41,118,897 N12D probably benign Het
Uba7 T C 9: 107,976,802 probably null Het
Upf3a A G 8: 13,796,591 R324G probably benign Het
Usp46 T G 5: 74,032,267 probably benign Het
Vmn2r14 T G 5: 109,216,411 probably null Het
Wbp2 G A 11: 116,080,547 probably benign Het
Wdpcp T A 11: 21,695,269 N232K probably damaging Het
Wdpcp T A 11: 21,695,271 M233K probably benign Het
Zfp157 A G 5: 138,447,541 I53V probably damaging Het
Other mutations in Alpk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Alpk2 APN 18 65305823 missense probably benign 0.27
IGL00478:Alpk2 APN 18 65307226 nonsense probably null
IGL00898:Alpk2 APN 18 65350573 missense probably benign 0.29
IGL00978:Alpk2 APN 18 65291534 splice site probably benign
IGL01093:Alpk2 APN 18 65349329 missense probably damaging 0.98
IGL01094:Alpk2 APN 18 65306602 missense probably damaging 0.96
IGL01109:Alpk2 APN 18 65307140 missense probably benign 0.09
IGL01370:Alpk2 APN 18 65350591 missense possibly damaging 0.56
IGL01393:Alpk2 APN 18 65307708 missense possibly damaging 0.88
IGL01629:Alpk2 APN 18 65300042 missense probably damaging 1.00
IGL01872:Alpk2 APN 18 65304753 missense probably benign 0.01
IGL01983:Alpk2 APN 18 65350682 missense probably damaging 1.00
IGL02294:Alpk2 APN 18 65306075 missense possibly damaging 0.45
IGL02333:Alpk2 APN 18 65349480 missense probably damaging 0.99
IGL02493:Alpk2 APN 18 65350331 missense probably benign 0.02
IGL02551:Alpk2 APN 18 65372751 missense probably damaging 1.00
IGL02864:Alpk2 APN 18 65307599 missense probably benign 0.12
IGL02901:Alpk2 APN 18 65306411 missense probably benign
IGL02954:Alpk2 APN 18 65306136 missense probably benign
IGL03257:Alpk2 APN 18 65349874 missense probably damaging 0.99
IGL03389:Alpk2 APN 18 65304866 missense possibly damaging 0.92
3-1:Alpk2 UTSW 18 65304888 missense probably damaging 0.99
PIT4131001:Alpk2 UTSW 18 65306379 missense possibly damaging 0.84
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0414:Alpk2 UTSW 18 65306159 missense probably benign 0.04
R0546:Alpk2 UTSW 18 65306717 missense probably benign 0.05
R0628:Alpk2 UTSW 18 65307296 missense possibly damaging 0.94
R0658:Alpk2 UTSW 18 65349487 missense probably damaging 1.00
R0731:Alpk2 UTSW 18 65305390 missense probably damaging 0.98
R0919:Alpk2 UTSW 18 65307473 missense probably benign
R1069:Alpk2 UTSW 18 65305014 missense probably benign 0.25
R1186:Alpk2 UTSW 18 65294341 critical splice acceptor site probably null
R1508:Alpk2 UTSW 18 65349305 missense probably damaging 1.00
R1535:Alpk2 UTSW 18 65350204 missense probably benign
R1558:Alpk2 UTSW 18 65350230 missense probably benign
R1600:Alpk2 UTSW 18 65378037 missense probably damaging 0.96
R1664:Alpk2 UTSW 18 65349873 missense probably damaging 0.96
R1672:Alpk2 UTSW 18 65280959 missense probably damaging 1.00
R1829:Alpk2 UTSW 18 65294094 missense possibly damaging 0.75
R2110:Alpk2 UTSW 18 65307080 missense possibly damaging 0.94
R2111:Alpk2 UTSW 18 65349774 missense probably benign
R2113:Alpk2 UTSW 18 65305683 missense probably benign 0.31
R2126:Alpk2 UTSW 18 65350368 nonsense probably null
R2198:Alpk2 UTSW 18 65350184 missense probably benign 0.42
R2227:Alpk2 UTSW 18 65378076 missense probably damaging 1.00
R2245:Alpk2 UTSW 18 65305163 missense probably benign 0.02
R2282:Alpk2 UTSW 18 65307626 missense probably benign
R2421:Alpk2 UTSW 18 65306616 missense probably benign 0.00
R2512:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R3105:Alpk2 UTSW 18 65350210 missense possibly damaging 0.57
R3700:Alpk2 UTSW 18 65305151 missense probably damaging 0.99
R4205:Alpk2 UTSW 18 65305211 missense possibly damaging 0.76
R4353:Alpk2 UTSW 18 65291452 missense possibly damaging 0.73
R4572:Alpk2 UTSW 18 65281004 missense probably damaging 1.00
R4584:Alpk2 UTSW 18 65306964 missense probably damaging 0.99
R4591:Alpk2 UTSW 18 65305823 missense probably benign 0.27
R4595:Alpk2 UTSW 18 65289748 missense probably damaging 1.00
R4648:Alpk2 UTSW 18 65349882 missense probably damaging 0.99
R4815:Alpk2 UTSW 18 65349955 missense probably damaging 1.00
R4828:Alpk2 UTSW 18 65349113 missense probably benign
R4910:Alpk2 UTSW 18 65266286 nonsense probably null
R5042:Alpk2 UTSW 18 65350508 nonsense probably null
R5295:Alpk2 UTSW 18 65305038 missense probably damaging 0.98
R5375:Alpk2 UTSW 18 65372738 missense probably damaging 1.00
R5475:Alpk2 UTSW 18 65307012 missense probably benign 0.16
R5480:Alpk2 UTSW 18 65349908 missense probably damaging 1.00
R5486:Alpk2 UTSW 18 65294354 splice site probably null
R5503:Alpk2 UTSW 18 65306241 missense probably benign 0.00
R5595:Alpk2 UTSW 18 65266248 missense probably damaging 1.00
R5648:Alpk2 UTSW 18 65349917 missense probably damaging 0.96
R5714:Alpk2 UTSW 18 65305461 missense possibly damaging 0.55
R5862:Alpk2 UTSW 18 65307289 missense probably damaging 1.00
R5894:Alpk2 UTSW 18 65281072 missense probably damaging 0.99
R5898:Alpk2 UTSW 18 65307623 missense probably damaging 0.99
R5936:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R6142:Alpk2 UTSW 18 65305385 missense possibly damaging 0.94
R6291:Alpk2 UTSW 18 65305901 missense possibly damaging 0.93
R6339:Alpk2 UTSW 18 65349806 missense probably benign 0.00
R6407:Alpk2 UTSW 18 65289738 missense probably benign 0.22
R6487:Alpk2 UTSW 18 65266183 missense possibly damaging 0.62
R6667:Alpk2 UTSW 18 65307740 missense probably damaging 1.00
R6786:Alpk2 UTSW 18 65306634 missense probably benign
R6833:Alpk2 UTSW 18 65306409 missense probably benign 0.08
R6984:Alpk2 UTSW 18 65305678 missense possibly damaging 0.95
R6999:Alpk2 UTSW 18 65304513 missense probably damaging 0.99
R7157:Alpk2 UTSW 18 65266277 nonsense probably null
R7167:Alpk2 UTSW 18 65306978 missense probably benign 0.40
R7225:Alpk2 UTSW 18 65305199 missense probably benign 0.00
R7409:Alpk2 UTSW 18 65306952 missense probably benign 0.01
R7533:Alpk2 UTSW 18 65304603 missense probably damaging 1.00
R7576:Alpk2 UTSW 18 65306816 missense possibly damaging 0.89
R7589:Alpk2 UTSW 18 65300073 missense probably damaging 1.00
R7598:Alpk2 UTSW 18 65304566 missense probably damaging 1.00
R7664:Alpk2 UTSW 18 65307002 missense probably benign 0.03
R7711:Alpk2 UTSW 18 65306484 missense probably benign
R7722:Alpk2 UTSW 18 65350157 missense probably damaging 1.00
R7783:Alpk2 UTSW 18 65306254 nonsense probably null
R7806:Alpk2 UTSW 18 65349416 missense probably benign
R7953:Alpk2 UTSW 18 65349830 missense probably damaging 1.00
R8024:Alpk2 UTSW 18 65305035 missense probably benign 0.01
R8043:Alpk2 UTSW 18 65349830 missense probably damaging 1.00
R8063:Alpk2 UTSW 18 65350346 missense probably benign 0.15
R8171:Alpk2 UTSW 18 65305983 missense probably benign 0.00
R8280:Alpk2 UTSW 18 65307203 missense probably benign
R8383:Alpk2 UTSW 18 65305398 missense probably benign 0.03
R8414:Alpk2 UTSW 18 65307471 missense possibly damaging 0.89
R8791:Alpk2 UTSW 18 65305526 missense probably benign 0.00
X0023:Alpk2 UTSW 18 65291400 missense probably damaging 1.00
X0027:Alpk2 UTSW 18 65307471 missense possibly damaging 0.89
X0063:Alpk2 UTSW 18 65307363 missense probably benign
X0064:Alpk2 UTSW 18 65349684 missense probably benign 0.09
Z1176:Alpk2 UTSW 18 65305611 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGATATGGAATCTCTGCTTCTAC -3'
(R):5'- CTGTTATATTTGAGCTGGCCGC -3'

Sequencing Primer
(F):5'- TTTCTTTGACAACCACACTAAGAAGC -3'
(R):5'- ATATTTGAGCTGGCCGCATCTC -3'
Posted On2015-06-12