Mutagenetix > Incidental Mutations

Incidental Mutation 'R4239:Alpk2'

321288

Institutional Source

Beutler Lab

Gene Symbol

Alpk2

Ensembl Gene

ENSMUSG00000032845

Gene Name

alpha-kinase 2

Synonyms

Hak

MMRRC Submission

041056-MU

Accession Numbers

Genbank: NM_001037294

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4239 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65265529-65393888 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 65300141 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1765 (I1765F)

Ref Sequence

ENSEMBL: ENSMUSP00000048752 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035548] [ENSMUST00000141250]

AlphaFold

Q91ZB0

Predicted Effect

probably damaging
Transcript: ENSMUST00000035548
AA Change: I1765F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000048752
Gene: ENSMUSG00000032845
AA Change: I1765F

Domain	Start	End	E-Value	Type
IGc2	24	94	9.34e-4	SMART
low complexity region	196	209	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	1025	1037	N/A	INTRINSIC
low complexity region	1337	1353	N/A	INTRINSIC
IG	1766	1849	2.27e-2	SMART
Alpha_kinase	1879	2098	3.72e-79	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000141250
AA Change: I1298F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000114658
Gene: ENSMUSG00000032845
AA Change: I1298F

Domain	Start	End	E-Value	Type
low complexity region	255	267	N/A	INTRINSIC
low complexity region	558	570	N/A	INTRINSIC
low complexity region	870	886	N/A	INTRINSIC
IG	1299	1382	2.27e-2	SMART
Alpha_kinase	1412	1603	2.45e-56	SMART

Meta Mutation Damage Score

0.1555

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (55/58)

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	T	C	9: 55,980,842	D397G	probably benign	Het
Ano5	T	A	7: 51,587,666	I696N	probably damaging	Het
Areg	A	T	5: 91,143,516	N106I	probably damaging	Het
Atad2b	A	G	12: 4,985,710	N759D	probably benign	Het
B4galnt4	T	C	7: 141,061,326	L18P	probably damaging	Het
Boc	T	C	16: 44,491,884	D605G	probably damaging	Het
Cfap46	G	T	7: 139,666,287	Q387K	possibly damaging	Het
Cfap74	C	A	4: 155,463,072	H1238Q	probably benign	Het
Clip2	A	G	5: 134,535,197		probably benign	Het
Cog4	T	C	8: 110,858,612	I303T	probably damaging	Het
Col18a1	C	T	10: 77,096,167	V363I	unknown	Het
Crip3	A	T	17: 46,431,230	K184*	probably null	Het
Ddi1	A	G	9: 6,265,799	M190T	probably benign	Het
Dnah3	G	A	7: 120,029,025	Q1459*	probably null	Het
Dpp8	A	G	9: 65,054,923	D415G	probably benign	Het
Ehhadh	T	G	16: 21,762,688	D518A	probably damaging	Het
Erbb2	A	G	11: 98,428,043	K549R	probably benign	Het
Fbxl3	G	A	14: 103,089,418	S176L	probably damaging	Het
Gm1979	T	C	5: 26,001,121	T154A	probably benign	Het
Gm6871	G	T	7: 41,545,780	T511K	probably damaging	Het
Gtf2h1	C	T	7: 46,805,065	A157V	probably benign	Het
Hexb	T	C	13: 97,176,751		probably benign	Het
Ifi214	A	T	1: 173,524,943	S307T	possibly damaging	Het
Ighv3-4	A	T	12: 114,253,913	D19E	probably benign	Het
Klk6	A	G	7: 43,829,173	H168R	probably benign	Het
Large2	A	G	2: 92,366,605		probably benign	Het
Myo5c	T	C	9: 75,283,942	I1086T	probably benign	Het
Nes	C	A	3: 87,979,359	P1598T	probably damaging	Het
Olfr1002	T	A	2: 85,648,303	Q6L	probably damaging	Het
Olfr539	A	G	7: 140,667,583	N99D	probably benign	Het
Olfr583	T	C	7: 103,051,796	V166A	probably benign	Het
Otud7a	A	G	7: 63,650,954	D47G	probably damaging	Het
Phactr1	T	A	13: 43,094,887	N437K	possibly damaging	Het
Plcb1	A	T	2: 135,344,158	I682F	probably damaging	Het
Plcz1	T	A	6: 140,040,618		probably null	Het
Prl7a1	T	A	13: 27,637,566	Q129L	possibly damaging	Het
Prrt4	T	C	6: 29,170,164	Y763C	probably damaging	Het
Psma7	T	C	2: 180,039,511		probably benign	Het
Serpinb6b	G	C	13: 32,972,263	C112S	probably damaging	Het
Slc14a2	G	A	18: 78,207,068	R62C	probably damaging	Het
Slc35f5	G	A	1: 125,572,474	A242T	possibly damaging	Het
Speer4b	T	C	5: 27,501,313	R19G	probably benign	Het
Trank1	A	G	9: 111,367,035	I1376V	probably benign	Het
Trbv12-2	A	G	6: 41,118,897	N12D	probably benign	Het
Uba7	T	C	9: 107,976,802		probably null	Het
Upf3a	A	G	8: 13,796,591	R324G	probably benign	Het
Usp46	T	G	5: 74,032,267		probably benign	Het
Vmn2r14	T	G	5: 109,216,411		probably null	Het
Wbp2	G	A	11: 116,080,547		probably benign	Het
Wdpcp	T	A	11: 21,695,269	N232K	probably damaging	Het
Wdpcp	T	A	11: 21,695,271	M233K	probably benign	Het
Zfp157	A	G	5: 138,447,541	I53V	probably damaging	Het

Other mutations in Alpk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Alpk2	APN	18	65305823	missense	probably benign	0.27
IGL00478:Alpk2	APN	18	65307226	nonsense	probably null
IGL00898:Alpk2	APN	18	65350573	missense	probably benign	0.29
IGL00978:Alpk2	APN	18	65291534	splice site	probably benign
IGL01093:Alpk2	APN	18	65349329	missense	probably damaging	0.98
IGL01094:Alpk2	APN	18	65306602	missense	probably damaging	0.96
IGL01109:Alpk2	APN	18	65307140	missense	probably benign	0.09
IGL01370:Alpk2	APN	18	65350591	missense	possibly damaging	0.56
IGL01393:Alpk2	APN	18	65307708	missense	possibly damaging	0.88
IGL01629:Alpk2	APN	18	65300042	missense	probably damaging	1.00
IGL01872:Alpk2	APN	18	65304753	missense	probably benign	0.01
IGL01983:Alpk2	APN	18	65350682	missense	probably damaging	1.00
IGL02294:Alpk2	APN	18	65306075	missense	possibly damaging	0.45
IGL02333:Alpk2	APN	18	65349480	missense	probably damaging	0.99
IGL02493:Alpk2	APN	18	65350331	missense	probably benign	0.02
IGL02551:Alpk2	APN	18	65372751	missense	probably damaging	1.00
IGL02864:Alpk2	APN	18	65307599	missense	probably benign	0.12
IGL02901:Alpk2	APN	18	65306411	missense	probably benign
IGL02954:Alpk2	APN	18	65306136	missense	probably benign
IGL03257:Alpk2	APN	18	65349874	missense	probably damaging	0.99
IGL03389:Alpk2	APN	18	65304866	missense	possibly damaging	0.92
3-1:Alpk2	UTSW	18	65304888	missense	probably damaging	0.99
PIT4131001:Alpk2	UTSW	18	65306379	missense	possibly damaging	0.84
R0098:Alpk2	UTSW	18	65349911	missense	probably damaging	1.00
R0098:Alpk2	UTSW	18	65349911	missense	probably damaging	1.00
R0414:Alpk2	UTSW	18	65306159	missense	probably benign	0.04
R0546:Alpk2	UTSW	18	65306717	missense	probably benign	0.05
R0628:Alpk2	UTSW	18	65307296	missense	possibly damaging	0.94
R0658:Alpk2	UTSW	18	65349487	missense	probably damaging	1.00
R0731:Alpk2	UTSW	18	65305390	missense	probably damaging	0.98
R0919:Alpk2	UTSW	18	65307473	missense	probably benign
R1069:Alpk2	UTSW	18	65305014	missense	probably benign	0.25
R1186:Alpk2	UTSW	18	65294341	critical splice acceptor site	probably null
R1508:Alpk2	UTSW	18	65349305	missense	probably damaging	1.00
R1535:Alpk2	UTSW	18	65350204	missense	probably benign
R1558:Alpk2	UTSW	18	65350230	missense	probably benign
R1600:Alpk2	UTSW	18	65378037	missense	probably damaging	0.96
R1664:Alpk2	UTSW	18	65349873	missense	probably damaging	0.96
R1672:Alpk2	UTSW	18	65280959	missense	probably damaging	1.00
R1829:Alpk2	UTSW	18	65294094	missense	possibly damaging	0.75
R2110:Alpk2	UTSW	18	65307080	missense	possibly damaging	0.94
R2111:Alpk2	UTSW	18	65349774	missense	probably benign
R2113:Alpk2	UTSW	18	65305683	missense	probably benign	0.31
R2126:Alpk2	UTSW	18	65350368	nonsense	probably null
R2198:Alpk2	UTSW	18	65350184	missense	probably benign	0.42
R2227:Alpk2	UTSW	18	65378076	missense	probably damaging	1.00
R2245:Alpk2	UTSW	18	65305163	missense	probably benign	0.02
R2282:Alpk2	UTSW	18	65307626	missense	probably benign
R2421:Alpk2	UTSW	18	65306616	missense	probably benign	0.00
R2512:Alpk2	UTSW	18	65350520	missense	probably damaging	0.96
R3105:Alpk2	UTSW	18	65350210	missense	possibly damaging	0.57
R3700:Alpk2	UTSW	18	65305151	missense	probably damaging	0.99
R4205:Alpk2	UTSW	18	65305211	missense	possibly damaging	0.76
R4353:Alpk2	UTSW	18	65291452	missense	possibly damaging	0.73
R4572:Alpk2	UTSW	18	65281004	missense	probably damaging	1.00
R4584:Alpk2	UTSW	18	65306964	missense	probably damaging	0.99
R4591:Alpk2	UTSW	18	65305823	missense	probably benign	0.27
R4595:Alpk2	UTSW	18	65289748	missense	probably damaging	1.00
R4648:Alpk2	UTSW	18	65349882	missense	probably damaging	0.99
R4815:Alpk2	UTSW	18	65349955	missense	probably damaging	1.00
R4828:Alpk2	UTSW	18	65349113	missense	probably benign
R4910:Alpk2	UTSW	18	65266286	nonsense	probably null
R5042:Alpk2	UTSW	18	65350508	nonsense	probably null
R5295:Alpk2	UTSW	18	65305038	missense	probably damaging	0.98
R5375:Alpk2	UTSW	18	65372738	missense	probably damaging	1.00
R5475:Alpk2	UTSW	18	65307012	missense	probably benign	0.16
R5480:Alpk2	UTSW	18	65349908	missense	probably damaging	1.00
R5486:Alpk2	UTSW	18	65294354	splice site	probably null
R5503:Alpk2	UTSW	18	65306241	missense	probably benign	0.00
R5595:Alpk2	UTSW	18	65266248	missense	probably damaging	1.00
R5648:Alpk2	UTSW	18	65349917	missense	probably damaging	0.96
R5714:Alpk2	UTSW	18	65305461	missense	possibly damaging	0.55
R5862:Alpk2	UTSW	18	65307289	missense	probably damaging	1.00
R5894:Alpk2	UTSW	18	65281072	missense	probably damaging	0.99
R5898:Alpk2	UTSW	18	65307623	missense	probably damaging	0.99
R5936:Alpk2	UTSW	18	65350520	missense	probably damaging	0.96
R6142:Alpk2	UTSW	18	65305385	missense	possibly damaging	0.94
R6291:Alpk2	UTSW	18	65305901	missense	possibly damaging	0.93
R6339:Alpk2	UTSW	18	65349806	missense	probably benign	0.00
R6407:Alpk2	UTSW	18	65289738	missense	probably benign	0.22
R6487:Alpk2	UTSW	18	65266183	missense	possibly damaging	0.62
R6667:Alpk2	UTSW	18	65307740	missense	probably damaging	1.00
R6786:Alpk2	UTSW	18	65306634	missense	probably benign
R6833:Alpk2	UTSW	18	65306409	missense	probably benign	0.08
R6984:Alpk2	UTSW	18	65305678	missense	possibly damaging	0.95
R6999:Alpk2	UTSW	18	65304513	missense	probably damaging	0.99
R7157:Alpk2	UTSW	18	65266277	nonsense	probably null
R7167:Alpk2	UTSW	18	65306978	missense	probably benign	0.40
R7225:Alpk2	UTSW	18	65305199	missense	probably benign	0.00
R7409:Alpk2	UTSW	18	65306952	missense	probably benign	0.01
R7533:Alpk2	UTSW	18	65304603	missense	probably damaging	1.00
R7576:Alpk2	UTSW	18	65306816	missense	possibly damaging	0.89
R7589:Alpk2	UTSW	18	65300073	missense	probably damaging	1.00
R7598:Alpk2	UTSW	18	65304566	missense	probably damaging	1.00
R7664:Alpk2	UTSW	18	65307002	missense	probably benign	0.03
R7711:Alpk2	UTSW	18	65306484	missense	probably benign
R7722:Alpk2	UTSW	18	65350157	missense	probably damaging	1.00
R7783:Alpk2	UTSW	18	65306254	nonsense	probably null
R7806:Alpk2	UTSW	18	65349416	missense	probably benign
R7953:Alpk2	UTSW	18	65349830	missense	probably damaging	1.00
R8024:Alpk2	UTSW	18	65305035	missense	probably benign	0.01
R8043:Alpk2	UTSW	18	65349830	missense	probably damaging	1.00
R8063:Alpk2	UTSW	18	65350346	missense	probably benign	0.15
R8171:Alpk2	UTSW	18	65305983	missense	probably benign	0.00
R8280:Alpk2	UTSW	18	65307203	missense	probably benign
R8383:Alpk2	UTSW	18	65305398	missense	probably benign	0.03
R8414:Alpk2	UTSW	18	65307471	missense	possibly damaging	0.89
R8791:Alpk2	UTSW	18	65305526	missense	probably benign	0.00
R8872:Alpk2	UTSW	18	65280906	missense	probably damaging	1.00
R9352:Alpk2	UTSW	18	65306712	missense	probably benign	0.01
R9449:Alpk2	UTSW	18	65291393	missense	probably damaging	1.00
X0023:Alpk2	UTSW	18	65291400	missense	probably damaging	1.00
X0027:Alpk2	UTSW	18	65307471	missense	possibly damaging	0.89
X0063:Alpk2	UTSW	18	65307363	missense	probably benign
X0064:Alpk2	UTSW	18	65349684	missense	probably benign	0.09
Z1176:Alpk2	UTSW	18	65305611	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGATATGGAATCTCTGCTTCTAC -3'
(R):5'- CTGTTATATTTGAGCTGGCCGC -3'

Sequencing Primer
(F):5'- TTTCTTTGACAACCACACTAAGAAGC -3'
(R):5'- ATATTTGAGCTGGCCGCATCTC -3'

Posted On

2015-06-12