Mutagenetix > Incidental Mutations

Incidental Mutation 'R4239:Slc14a2'

321289

Institutional Source

Beutler Lab

Gene Symbol

Slc14a2

Ensembl Gene

ENSMUSG00000024552

Gene Name

solute carrier family 14 (urea transporter), member 2

Synonyms

UT-A5, UT-A3

MMRRC Submission

041056-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4239 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78146940-78209094 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 78207068 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 62 (R62C)

Ref Sequence

ENSEMBL: ENSMUSP00000025434 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025434] [ENSMUST00000163367]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000025434
AA Change: R62C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000025434
Gene: ENSMUSG00000024552
AA Change: R62C

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
low complexity region	31	43	N/A	INTRINSIC
low complexity region	82	97	N/A	INTRINSIC
Pfam:UT	128	423	1.9e-105	PFAM
low complexity region	460	471	N/A	INTRINSIC
Pfam:UT	591	886	7.5e-112	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163367

SMART Domains

Protein: ENSMUSP00000126416
Gene: ENSMUSG00000024552

Domain	Start	End	E-Value	Type
Pfam:UT	1	292	3.4e-113	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (55/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the urea transporter family. In mammalian cells, urea is the chief end product of nitrogen catabolism, and plays an important role in the urinary concentration mechanism. This protein is expressed in the inner medulla of the kidney, and mediates rapid transepithelial urea transport across the inner medullary collecting duct. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mice lacking the collecting duct specific isoforms display decreased urea permeability and urine osmolality and increased urine flow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	T	C	9: 55,980,842	D397G	probably benign	Het
Alpk2	T	A	18: 65,300,141	I1765F	probably damaging	Het
Ano5	T	A	7: 51,587,666	I696N	probably damaging	Het
Areg	A	T	5: 91,143,516	N106I	probably damaging	Het
Atad2b	A	G	12: 4,985,710	N759D	probably benign	Het
B4galnt4	T	C	7: 141,061,326	L18P	probably damaging	Het
Boc	T	C	16: 44,491,884	D605G	probably damaging	Het
Cfap46	G	T	7: 139,666,287	Q387K	possibly damaging	Het
Cfap74	C	A	4: 155,463,072	H1238Q	probably benign	Het
Clip2	A	G	5: 134,535,197		probably benign	Het
Cog4	T	C	8: 110,858,612	I303T	probably damaging	Het
Col18a1	C	T	10: 77,096,167	V363I	unknown	Het
Crip3	A	T	17: 46,431,230	K184*	probably null	Het
Ddi1	A	G	9: 6,265,799	M190T	probably benign	Het
Dnah3	G	A	7: 120,029,025	Q1459*	probably null	Het
Dpp8	A	G	9: 65,054,923	D415G	probably benign	Het
Ehhadh	T	G	16: 21,762,688	D518A	probably damaging	Het
Erbb2	A	G	11: 98,428,043	K549R	probably benign	Het
Fbxl3	G	A	14: 103,089,418	S176L	probably damaging	Het
Gm1979	T	C	5: 26,001,121	T154A	probably benign	Het
Gm6871	G	T	7: 41,545,780	T511K	probably damaging	Het
Gtf2h1	C	T	7: 46,805,065	A157V	probably benign	Het
Hexb	T	C	13: 97,176,751		probably benign	Het
Ifi214	A	T	1: 173,524,943	S307T	possibly damaging	Het
Ighv3-4	A	T	12: 114,253,913	D19E	probably benign	Het
Klk6	A	G	7: 43,829,173	H168R	probably benign	Het
Large2	A	G	2: 92,366,605		probably benign	Het
Myo5c	T	C	9: 75,283,942	I1086T	probably benign	Het
Nes	C	A	3: 87,979,359	P1598T	probably damaging	Het
Olfr1002	T	A	2: 85,648,303	Q6L	probably damaging	Het
Olfr539	A	G	7: 140,667,583	N99D	probably benign	Het
Olfr583	T	C	7: 103,051,796	V166A	probably benign	Het
Otud7a	A	G	7: 63,650,954	D47G	probably damaging	Het
Phactr1	T	A	13: 43,094,887	N437K	possibly damaging	Het
Plcb1	A	T	2: 135,344,158	I682F	probably damaging	Het
Plcz1	T	A	6: 140,040,618		probably null	Het
Prl7a1	T	A	13: 27,637,566	Q129L	possibly damaging	Het
Prrt4	T	C	6: 29,170,164	Y763C	probably damaging	Het
Psma7	T	C	2: 180,039,511		probably benign	Het
Serpinb6b	G	C	13: 32,972,263	C112S	probably damaging	Het
Slc35f5	G	A	1: 125,572,474	A242T	possibly damaging	Het
Speer4b	T	C	5: 27,501,313	R19G	probably benign	Het
Trank1	A	G	9: 111,367,035	I1376V	probably benign	Het
Trbv12-2	A	G	6: 41,118,897	N12D	probably benign	Het
Uba7	T	C	9: 107,976,802		probably null	Het
Upf3a	A	G	8: 13,796,591	R324G	probably benign	Het
Usp46	T	G	5: 74,032,267		probably benign	Het
Vmn2r14	T	G	5: 109,216,411		probably null	Het
Wbp2	G	A	11: 116,080,547		probably benign	Het
Wdpcp	T	A	11: 21,695,269	N232K	probably damaging	Het
Wdpcp	T	A	11: 21,695,271	M233K	probably benign	Het
Zfp157	A	G	5: 138,447,541	I53V	probably damaging	Het

Other mutations in Slc14a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Slc14a2	APN	18	78150438	missense	possibly damaging	0.65
IGL00763:Slc14a2	APN	18	78192238	missense	probably damaging	1.00
IGL01359:Slc14a2	APN	18	78154108	missense	probably benign	0.01
IGL01400:Slc14a2	APN	18	78192213	missense	probably damaging	1.00
IGL01450:Slc14a2	APN	18	78183530	missense	probably damaging	0.97
IGL01469:Slc14a2	APN	18	78155566	missense	probably damaging	0.98
IGL02231:Slc14a2	APN	18	78209021	missense	possibly damaging	0.92
IGL02340:Slc14a2	APN	18	78163126	missense	probably damaging	1.00
IGL02542:Slc14a2	APN	18	78209087	missense	probably benign
xi_ning	UTSW	18	78195747	missense	probably benign	0.01
IGL02991:Slc14a2	UTSW	18	78205834	start codon destroyed	probably null	0.77
R0131:Slc14a2	UTSW	18	78192123	missense	probably damaging	1.00
R0131:Slc14a2	UTSW	18	78192123	missense	probably damaging	1.00
R0132:Slc14a2	UTSW	18	78192123	missense	probably damaging	1.00
R0601:Slc14a2	UTSW	18	78157179	nonsense	probably null
R1677:Slc14a2	UTSW	18	78163204	missense	probably benign
R1749:Slc14a2	UTSW	18	78147080	missense	possibly damaging	0.67
R2014:Slc14a2	UTSW	18	78150386	splice site	probably benign
R2034:Slc14a2	UTSW	18	78183583	missense	probably damaging	0.99
R2264:Slc14a2	UTSW	18	78163089	splice site	probably benign
R2278:Slc14a2	UTSW	18	78159944	missense	probably benign	0.01
R2920:Slc14a2	UTSW	18	78158297	nonsense	probably null
R3878:Slc14a2	UTSW	18	78159074	missense	probably benign
R4086:Slc14a2	UTSW	18	78205783	missense	probably damaging	1.00
R4237:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4238:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4300:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4373:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4375:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4376:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4440:Slc14a2	UTSW	18	78195747	missense	probably benign	0.01
R4551:Slc14a2	UTSW	18	78195853	missense	probably benign	0.02
R4636:Slc14a2	UTSW	18	78195792	missense	possibly damaging	0.88
R4749:Slc14a2	UTSW	18	78155581	missense	probably damaging	1.00
R4921:Slc14a2	UTSW	18	78192188	missense	probably damaging	0.97
R4983:Slc14a2	UTSW	18	78150401	missense	probably damaging	0.98
R5114:Slc14a2	UTSW	18	78195748	missense	possibly damaging	0.62
R5164:Slc14a2	UTSW	18	78157272	missense	probably damaging	1.00
R5386:Slc14a2	UTSW	18	78185840	missense	possibly damaging	0.65
R5433:Slc14a2	UTSW	18	78208928	missense	probably damaging	1.00
R5558:Slc14a2	UTSW	18	78159166	missense	possibly damaging	0.94
R5571:Slc14a2	UTSW	18	78209067	missense	possibly damaging	0.73
R5693:Slc14a2	UTSW	18	78147014	missense	probably benign	0.23
R5715:Slc14a2	UTSW	18	78158336	missense	probably damaging	1.00
R5719:Slc14a2	UTSW	18	78209042	missense	probably benign	0.06
R6160:Slc14a2	UTSW	18	78158975	critical splice donor site	probably null
R6352:Slc14a2	UTSW	18	78209094	start codon destroyed	probably null
R6380:Slc14a2	UTSW	18	78146975	missense	probably benign	0.00
R6444:Slc14a2	UTSW	18	78154102	missense	probably damaging	0.98
R6480:Slc14a2	UTSW	18	78159082	missense	possibly damaging	0.80
R6732:Slc14a2	UTSW	18	78192174	missense	probably damaging	1.00
R7038:Slc14a2	UTSW	18	78159037	missense	probably damaging	0.98
R7553:Slc14a2	UTSW	18	78155588	missense	probably damaging	1.00
R7558:Slc14a2	UTSW	18	78192119	missense	probably benign	0.07
R7617:Slc14a2	UTSW	18	78159941	missense	probably benign
R7693:Slc14a2	UTSW	18	78154003	missense	possibly damaging	0.81
R7874:Slc14a2	UTSW	18	78160768	missense	probably benign	0.01
R8144:Slc14a2	UTSW	18	78184544	critical splice donor site	probably null
R9205:Slc14a2	UTSW	18	78195736	missense	probably benign	0.19
R9356:Slc14a2	UTSW	18	78184608	missense	probably null	0.02
Z1088:Slc14a2	UTSW	18	78195780	missense	probably damaging	1.00
Z1176:Slc14a2	UTSW	18	78157368	missense	probably damaging	1.00
Z1176:Slc14a2	UTSW	18	78157369	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- GACACTCACCTTTCAGCCAG -3'
(R):5'- GTCCCCAAATGTCCCTATCAAG -3'

Sequencing Primer
(F):5'- AGCCAGTTCTTGCATTCCTTCATG -3'
(R):5'- CAAGTACTTATAATCCCAGCAGATG -3'

Posted On

2015-06-12