Incidental Mutation 'R4250:Rxfp1'
ID 321295
Institutional Source Beutler Lab
Gene Symbol Rxfp1
Ensembl Gene ENSMUSG00000034009
Gene Name relaxin/insulin-like family peptide receptor 1
Synonyms LOC381489, Lgr7
MMRRC Submission 041066-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.149) question?
Stock # R4250 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 79548918-79645187 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79559579 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 414 (V414A)
Ref Sequence ENSEMBL: ENSMUSP00000077611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078527] [ENSMUST00000182491]
AlphaFold Q6R6I7
Predicted Effect probably benign
Transcript: ENSMUST00000078527
AA Change: V414A

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000077611
Gene: ENSMUSG00000034009
AA Change: V414A

DomainStartEndE-ValueType
LDLa 26 64 1.61e-8 SMART
LRRNT 101 130 9.51e-1 SMART
LRR 126 148 3.65e1 SMART
LRR 149 172 1.19e1 SMART
LRR_TYP 173 196 4.61e-5 SMART
LRR 197 220 1.86e0 SMART
LRR 221 244 1.86e2 SMART
LRR 246 269 2.03e1 SMART
LRR 270 293 1.76e2 SMART
LRR_TYP 294 317 4.24e-4 SMART
LRR 318 341 1.15e1 SMART
LRR 342 365 3.65e1 SMART
Pfam:7tm_1 422 681 2.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182491
SMART Domains Protein: ENSMUSP00000138578
Gene: ENSMUSG00000034009

DomainStartEndE-ValueType
LDLa 26 64 1.61e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183199
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility, particularly at younger ages and early generations. Impaired nipple development prevents nursing by females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl2a1d C T 9: 88,613,706 (GRCm39) V23I probably benign Het
Birc2 A T 9: 7,818,936 (GRCm39) L552M probably benign Het
Chst3 A T 10: 60,021,890 (GRCm39) L319Q probably damaging Het
Col19a1 T C 1: 24,564,726 (GRCm39) T296A unknown Het
Colgalt2 A T 1: 152,365,638 (GRCm39) I313L probably benign Het
Dclre1b A C 3: 103,711,400 (GRCm39) probably null Het
Ezr A T 17: 7,022,196 (GRCm39) I94N probably damaging Het
Fry T G 5: 150,233,825 (GRCm39) I99S probably damaging Het
Hba-x T C 11: 32,228,000 (GRCm39) Y155H probably damaging Het
Herc3 T A 6: 58,893,501 (GRCm39) V921D probably damaging Het
Hoxb5 T C 11: 96,194,854 (GRCm39) S139P possibly damaging Het
Icam5 A G 9: 20,949,035 (GRCm39) T796A probably damaging Het
Igkv8-26 G A 6: 70,170,230 (GRCm39) V7I probably benign Het
Ikzf1 C T 11: 11,704,166 (GRCm39) T194M probably damaging Het
Kif14 G T 1: 136,401,126 (GRCm39) M492I possibly damaging Het
Lmtk3 G A 7: 45,443,486 (GRCm39) C723Y possibly damaging Het
Or5b97 T C 19: 12,878,368 (GRCm39) M259V probably benign Het
Padi2 A G 4: 140,633,857 (GRCm39) Y38C probably damaging Het
Pilra A T 5: 137,821,814 (GRCm39) S274T probably benign Het
Pkd1l1 C T 11: 8,815,543 (GRCm39) R1456K possibly damaging Het
Rreb1 T C 13: 38,077,869 (GRCm39) V27A possibly damaging Het
Satl1 A G X: 111,316,033 (GRCm39) S141P probably benign Het
Sirt1 T A 10: 63,172,877 (GRCm39) probably null Het
Slc5a6 A G 5: 31,195,062 (GRCm39) S512P probably benign Het
Snx8 A G 5: 140,341,800 (GRCm39) L121P probably damaging Het
Sp7 T A 15: 102,267,327 (GRCm39) T160S possibly damaging Het
Tcte1 A G 17: 45,850,617 (GRCm39) I298V probably benign Het
Trmt9b C A 8: 36,979,366 (GRCm39) T323K probably benign Het
Ttc4 G A 4: 106,522,880 (GRCm39) T346I probably damaging Het
Ttn T C 2: 76,544,056 (GRCm39) T32977A probably damaging Het
Yeats2 A G 16: 19,975,685 (GRCm39) K114E possibly damaging Het
Zdbf2 T C 1: 63,342,020 (GRCm39) V133A possibly damaging Het
Other mutations in Rxfp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Rxfp1 APN 3 79,559,523 (GRCm39) missense possibly damaging 0.81
IGL01962:Rxfp1 APN 3 79,594,175 (GRCm39) missense probably damaging 1.00
IGL01975:Rxfp1 APN 3 79,567,385 (GRCm39) missense possibly damaging 0.95
IGL01998:Rxfp1 APN 3 79,567,403 (GRCm39) missense probably benign 0.01
IGL02049:Rxfp1 APN 3 79,557,799 (GRCm39) missense probably damaging 0.99
IGL02153:Rxfp1 APN 3 79,567,427 (GRCm39) missense probably benign 0.00
IGL02490:Rxfp1 APN 3 79,559,474 (GRCm39) critical splice donor site probably null
IGL02526:Rxfp1 APN 3 79,578,153 (GRCm39) critical splice donor site probably null
IGL02985:Rxfp1 APN 3 79,559,533 (GRCm39) missense possibly damaging 0.65
IGL03252:Rxfp1 APN 3 79,574,990 (GRCm39) missense probably benign 0.29
juggler UTSW 3 79,557,898 (GRCm39) nonsense probably null
R0123:Rxfp1 UTSW 3 79,564,783 (GRCm39) missense probably damaging 1.00
R0134:Rxfp1 UTSW 3 79,564,783 (GRCm39) missense probably damaging 1.00
R0230:Rxfp1 UTSW 3 79,552,282 (GRCm39) missense probably damaging 1.00
R0257:Rxfp1 UTSW 3 79,589,842 (GRCm39) missense possibly damaging 0.61
R0265:Rxfp1 UTSW 3 79,574,961 (GRCm39) missense probably benign 0.00
R0362:Rxfp1 UTSW 3 79,645,100 (GRCm39) start codon destroyed probably null 0.99
R0394:Rxfp1 UTSW 3 79,559,684 (GRCm39) missense possibly damaging 0.58
R0422:Rxfp1 UTSW 3 79,558,038 (GRCm39) missense probably benign 0.00
R0547:Rxfp1 UTSW 3 79,612,876 (GRCm39) splice site probably null
R0627:Rxfp1 UTSW 3 79,555,518 (GRCm39) missense probably benign 0.00
R0671:Rxfp1 UTSW 3 79,570,600 (GRCm39) splice site probably null
R1309:Rxfp1 UTSW 3 79,570,599 (GRCm39) splice site probably null
R1756:Rxfp1 UTSW 3 79,578,188 (GRCm39) missense probably benign 0.11
R1803:Rxfp1 UTSW 3 79,645,076 (GRCm39) missense probably benign
R2415:Rxfp1 UTSW 3 79,570,626 (GRCm39) missense probably benign 0.14
R2862:Rxfp1 UTSW 3 79,589,778 (GRCm39) missense possibly damaging 0.80
R4087:Rxfp1 UTSW 3 79,552,256 (GRCm39) missense probably damaging 0.99
R4091:Rxfp1 UTSW 3 79,552,068 (GRCm39) missense probably benign
R4335:Rxfp1 UTSW 3 79,594,105 (GRCm39) critical splice donor site probably null
R4447:Rxfp1 UTSW 3 79,559,434 (GRCm39) intron probably benign
R4607:Rxfp1 UTSW 3 79,594,196 (GRCm39) missense probably damaging 1.00
R4608:Rxfp1 UTSW 3 79,594,196 (GRCm39) missense probably damaging 1.00
R4676:Rxfp1 UTSW 3 79,612,975 (GRCm39) missense probably damaging 1.00
R4768:Rxfp1 UTSW 3 79,594,175 (GRCm39) missense probably damaging 1.00
R4812:Rxfp1 UTSW 3 79,557,889 (GRCm39) missense probably benign 0.00
R4909:Rxfp1 UTSW 3 79,552,109 (GRCm39) missense probably benign
R5059:Rxfp1 UTSW 3 79,570,619 (GRCm39) missense probably benign
R5131:Rxfp1 UTSW 3 79,559,471 (GRCm39) splice site probably null
R5641:Rxfp1 UTSW 3 79,594,199 (GRCm39) missense probably damaging 0.98
R5711:Rxfp1 UTSW 3 79,586,054 (GRCm39) missense probably damaging 1.00
R5757:Rxfp1 UTSW 3 79,568,627 (GRCm39) missense possibly damaging 0.89
R5856:Rxfp1 UTSW 3 79,570,620 (GRCm39) missense possibly damaging 0.76
R6296:Rxfp1 UTSW 3 79,575,155 (GRCm39) missense probably damaging 1.00
R6462:Rxfp1 UTSW 3 79,555,596 (GRCm39) missense probably benign 0.07
R6730:Rxfp1 UTSW 3 79,557,898 (GRCm39) nonsense probably null
R7059:Rxfp1 UTSW 3 79,559,576 (GRCm39) missense probably damaging 1.00
R7530:Rxfp1 UTSW 3 79,557,768 (GRCm39) missense probably benign 0.18
R7626:Rxfp1 UTSW 3 79,555,397 (GRCm39) missense probably damaging 0.99
R7684:Rxfp1 UTSW 3 79,578,214 (GRCm39) missense possibly damaging 0.66
R7951:Rxfp1 UTSW 3 79,559,682 (GRCm39) missense probably damaging 1.00
R8723:Rxfp1 UTSW 3 79,557,802 (GRCm39) missense probably benign
R8786:Rxfp1 UTSW 3 79,570,677 (GRCm39) critical splice acceptor site probably null
R8887:Rxfp1 UTSW 3 79,559,289 (GRCm39) intron probably benign
R8939:Rxfp1 UTSW 3 79,552,231 (GRCm39) missense probably damaging 0.99
R9245:Rxfp1 UTSW 3 79,552,261 (GRCm39) missense probably benign 0.12
R9574:Rxfp1 UTSW 3 79,563,581 (GRCm39) missense probably benign 0.01
R9579:Rxfp1 UTSW 3 79,557,946 (GRCm39) missense probably damaging 1.00
R9799:Rxfp1 UTSW 3 79,578,182 (GRCm39) missense probably damaging 1.00
Z1088:Rxfp1 UTSW 3 79,613,011 (GRCm39) missense probably damaging 1.00
Z1177:Rxfp1 UTSW 3 79,559,674 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCCCACAGAATTTATTTTCTAGTAGC -3'
(R):5'- TGTAGTTCTTACCCACACATGC -3'

Sequencing Primer
(F):5'- GTAGCAACGATTTCAAGCCTTG -3'
(R):5'- CCCACACATGCTTTTACTATAAAGTC -3'
Posted On 2015-06-12