Incidental Mutation 'R4250:Padi2'
ID321298
Institutional Source Beutler Lab
Gene Symbol Padi2
Ensembl Gene ENSMUSG00000028927
Gene Namepeptidyl arginine deiminase, type II
SynonymsPAD type II, Pdi, Pdi2
MMRRC Submission 041066-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R4250 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location140906344-140952586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140906546 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 38 (Y38C)
Ref Sequence ENSEMBL: ENSMUSP00000030765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030765]
Predicted Effect probably damaging
Transcript: ENSMUST00000030765
AA Change: Y38C

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030765
Gene: ENSMUSG00000028927
AA Change: Y38C

DomainStartEndE-ValueType
Pfam:PAD_N 9 122 1.7e-36 PFAM
Pfam:PAD_M 124 282 4e-71 PFAM
Pfam:PAD 292 670 3.8e-174 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. The type II enzyme is the most widely expressed family member. Known substrates for this enzyme include myelin basic protein in the central nervous system and vimentin in skeletal muscle and macrophages. This enzyme is thought to play a role in the onset and progression of neurodegenerative human disorders, including Alzheimer disease and multiple sclerosis, and it has also been implicated in glaucoma pathogenesis. This gene exists in a cluster with four other paralogous genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired ATP- or calcium ionophore ionomycin-induced citrullination of mast cells or of proteins following induction of EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik C A 8: 36,512,212 T323K probably benign Het
Bcl2a1d C T 9: 88,731,653 V23I probably benign Het
Birc2 A T 9: 7,818,935 L552M probably benign Het
Chst3 A T 10: 60,186,068 L319Q probably damaging Het
Col19a1 T C 1: 24,525,645 T296A unknown Het
Colgalt2 A T 1: 152,489,887 I313L probably benign Het
Dclre1b A C 3: 103,804,084 probably null Het
Ezr A T 17: 6,754,797 I94N probably damaging Het
Fry T G 5: 150,310,360 I99S probably damaging Het
Hba-x T C 11: 32,278,000 Y155H probably damaging Het
Herc3 T A 6: 58,916,516 V921D probably damaging Het
Hoxb5 T C 11: 96,304,028 S139P possibly damaging Het
Icam5 A G 9: 21,037,739 T796A probably damaging Het
Igkv8-26 G A 6: 70,193,246 V7I probably benign Het
Ikzf1 C T 11: 11,754,166 T194M probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Olfr1447 T C 19: 12,901,004 M259V probably benign Het
Pilra A T 5: 137,823,552 S274T probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Rreb1 T C 13: 37,893,893 V27A possibly damaging Het
Rxfp1 A G 3: 79,652,272 V414A probably benign Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Sirt1 T A 10: 63,337,098 probably null Het
Slc5a6 A G 5: 31,037,718 S512P probably benign Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sp7 T A 15: 102,358,892 T160S possibly damaging Het
Tcte1 A G 17: 45,539,691 I298V probably benign Het
Ttc4 G A 4: 106,665,683 T346I probably damaging Het
Ttn T C 2: 76,713,712 T32977A probably damaging Het
Yeats2 A G 16: 20,156,935 K114E possibly damaging Het
Zdbf2 T C 1: 63,302,861 V133A possibly damaging Het
Other mutations in Padi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Padi2 APN 4 140917637 missense probably benign 0.27
IGL01374:Padi2 APN 4 140933185 missense probably damaging 1.00
IGL01608:Padi2 APN 4 140932230 missense probably damaging 1.00
IGL02085:Padi2 APN 4 140927157 nonsense probably null
IGL02593:Padi2 APN 4 140949842 missense probably damaging 1.00
IGL02668:Padi2 APN 4 140949880 missense probably benign 0.02
IGL03341:Padi2 APN 4 140927113 missense probably benign 0.06
R0116:Padi2 UTSW 4 140926239 missense probably benign 0.00
R2045:Padi2 UTSW 4 140937930 missense probably damaging 1.00
R2079:Padi2 UTSW 4 140933196 missense probably damaging 1.00
R3022:Padi2 UTSW 4 140937988 missense possibly damaging 0.79
R3079:Padi2 UTSW 4 140949878 missense probably damaging 0.99
R3780:Padi2 UTSW 4 140917737 missense probably benign 0.00
R4276:Padi2 UTSW 4 140936548 missense possibly damaging 0.93
R4647:Padi2 UTSW 4 140944446 missense probably damaging 1.00
R5058:Padi2 UTSW 4 140932121 missense probably benign 0.00
R5452:Padi2 UTSW 4 140932071 missense probably benign 0.26
R5471:Padi2 UTSW 4 140933208 missense possibly damaging 0.90
R5489:Padi2 UTSW 4 140944488 missense probably damaging 0.99
R5519:Padi2 UTSW 4 140949222 missense probably damaging 1.00
R5666:Padi2 UTSW 4 140949231 missense possibly damaging 0.76
R5793:Padi2 UTSW 4 140933190 missense probably benign 0.04
R5913:Padi2 UTSW 4 140917641 missense probably benign 0.00
R5929:Padi2 UTSW 4 140944537 critical splice donor site probably null
R5933:Padi2 UTSW 4 140917641 missense probably benign 0.00
R6478:Padi2 UTSW 4 140917637 missense probably benign 0.00
R6809:Padi2 UTSW 4 140946766 splice site probably null
R7075:Padi2 UTSW 4 140933217 missense probably damaging 0.96
R7313:Padi2 UTSW 4 140932768 missense probably damaging 0.99
R7380:Padi2 UTSW 4 140917686 nonsense probably null
R7391:Padi2 UTSW 4 140937955 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGCAGATCCAATCCAAGAGG -3'
(R):5'- AACTGTGTGTCTTAGAGGGGCC -3'

Sequencing Primer
(F):5'- GCTGCTGCTTAAGGCCG -3'
(R):5'- CCTCAGGATTGCATGGAAGTG -3'
Posted On2015-06-12