Incidental Mutation 'R4250:Chst3'
ID321312
Institutional Source Beutler Lab
Gene Symbol Chst3
Ensembl Gene ENSMUSG00000057337
Gene Namecarbohydrate (chondroitin 6/keratan) sulfotransferase 3
SynonymsGST-0, C6ST-1, C6ST
MMRRC Submission 041066-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R4250 (G1)
Quality Score196
Status Not validated
Chromosome10
Chromosomal Location60181532-60219260 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60186068 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 319 (L319Q)
Ref Sequence ENSEMBL: ENSMUSP00000131532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068690] [ENSMUST00000135158] [ENSMUST00000167915]
Predicted Effect probably damaging
Transcript: ENSMUST00000068690
AA Change: L319Q

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065010
Gene: ENSMUSG00000057337
AA Change: L319Q

DomainStartEndE-ValueType
transmembrane domain 20 38 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 88 101 N/A INTRINSIC
Pfam:Sulfotransfer_1 126 445 4.2e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135158
AA Change: L325Q

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126281
Gene: ENSMUSG00000057337
AA Change: L325Q

DomainStartEndE-ValueType
transmembrane domain 26 44 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 94 107 N/A INTRINSIC
Pfam:Sulfotransfer_1 132 451 4.9e-57 PFAM
Pfam:Sulfotransfer_3 133 391 1.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167915
AA Change: L319Q

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131532
Gene: ENSMUSG00000057337
AA Change: L319Q

DomainStartEndE-ValueType
transmembrane domain 20 38 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 88 101 N/A INTRINSIC
Pfam:Sulfotransfer_1 126 445 4.2e-57 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which catalyzes the sulfation of chondroitin, a proteoglycan found in the extracellular matrix and most cells which is involved in cell migration and differentiation. Mutations in this gene are associated with spondylepiphyseal dysplasia and humerospinal dysostosis. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutation of this gene results in significantly reduced numbers of naive T lymphocytes in the spleen at 5-6 weeks of age. Brain development and morphology is normal in mutant animals but for some alleles behavioral abnormalities are seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik C A 8: 36,512,212 T323K probably benign Het
Bcl2a1d C T 9: 88,731,653 V23I probably benign Het
Birc2 A T 9: 7,818,935 L552M probably benign Het
Col19a1 T C 1: 24,525,645 T296A unknown Het
Colgalt2 A T 1: 152,489,887 I313L probably benign Het
Dclre1b A C 3: 103,804,084 probably null Het
Ezr A T 17: 6,754,797 I94N probably damaging Het
Fry T G 5: 150,310,360 I99S probably damaging Het
Hba-x T C 11: 32,278,000 Y155H probably damaging Het
Herc3 T A 6: 58,916,516 V921D probably damaging Het
Hoxb5 T C 11: 96,304,028 S139P possibly damaging Het
Icam5 A G 9: 21,037,739 T796A probably damaging Het
Igkv8-26 G A 6: 70,193,246 V7I probably benign Het
Ikzf1 C T 11: 11,754,166 T194M probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Olfr1447 T C 19: 12,901,004 M259V probably benign Het
Padi2 A G 4: 140,906,546 Y38C probably damaging Het
Pilra A T 5: 137,823,552 S274T probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Rreb1 T C 13: 37,893,893 V27A possibly damaging Het
Rxfp1 A G 3: 79,652,272 V414A probably benign Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Sirt1 T A 10: 63,337,098 probably null Het
Slc5a6 A G 5: 31,037,718 S512P probably benign Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sp7 T A 15: 102,358,892 T160S possibly damaging Het
Tcte1 A G 17: 45,539,691 I298V probably benign Het
Ttc4 G A 4: 106,665,683 T346I probably damaging Het
Ttn T C 2: 76,713,712 T32977A probably damaging Het
Yeats2 A G 16: 20,156,935 K114E possibly damaging Het
Zdbf2 T C 1: 63,302,861 V133A possibly damaging Het
Other mutations in Chst3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Chst3 APN 10 60185619 missense possibly damaging 0.90
IGL01301:Chst3 APN 10 60185832 missense probably damaging 1.00
IGL01760:Chst3 APN 10 60186470 missense probably damaging 1.00
IGL03036:Chst3 APN 10 60186439 nonsense probably null
ANU18:Chst3 UTSW 10 60185832 missense probably damaging 1.00
R0462:Chst3 UTSW 10 60186713 missense probably benign
R0501:Chst3 UTSW 10 60186227 missense probably damaging 0.99
R1698:Chst3 UTSW 10 60185703 missense probably benign 0.19
R1807:Chst3 UTSW 10 60186308 missense probably benign 0.22
Z1176:Chst3 UTSW 10 60185676 missense possibly damaging 0.56
Z1177:Chst3 UTSW 10 60186260 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAAGCTGTACATCTCTCGGGC -3'
(R):5'- GAAGTACCACTGCAGGAACC -3'

Sequencing Primer
(F):5'- TCTCGGGCCTTCTGCAGTG -3'
(R):5'- ACTCAACGTGACCTTGGC -3'
Posted On2015-06-12