Incidental Mutation 'R4250:Hoxb5'
ID321317
Institutional Source Beutler Lab
Gene Symbol Hoxb5
Ensembl Gene ENSMUSG00000038700
Gene Namehomeobox B5
SynonymsHox-2.1
MMRRC Submission 041066-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4250 (G1)
Quality Score161
Status Not validated
Chromosome11
Chromosomal Location96303336-96306121 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96304028 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 139 (S139P)
Ref Sequence ENSEMBL: ENSMUSP00000035423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000704] [ENSMUST00000049272] [ENSMUST00000173432]
Predicted Effect probably benign
Transcript: ENSMUST00000000704
SMART Domains Protein: ENSMUSP00000000704
Gene: ENSMUSG00000000690

DomainStartEndE-ValueType
low complexity region 54 71 N/A INTRINSIC
HOX 146 208 1.49e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000049272
AA Change: S139P

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035423
Gene: ENSMUSG00000038700
AA Change: S139P

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 135 158 N/A INTRINSIC
HOX 194 256 1.63e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150698
Predicted Effect probably benign
Transcript: ENSMUST00000173432
SMART Domains Protein: ENSMUSP00000133281
Gene: ENSMUSG00000000690

DomainStartEndE-ValueType
low complexity region 54 71 N/A INTRINSIC
HOX 146 208 1.49e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190470
Meta Mutation Damage Score 0.1541 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Antp homeobox family and encodes a nuclear protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in lung and gut development. Increased expression of this gene is associated with a distinct biologic subset of acute myeloid leukemia (AML) and the occurrence of bronchopulmonary sequestration (BPS) and congenital cystic adenomatoid malformation (CCAM) tissue. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but exhibit a rostral shift of the shoulder girdle resulting in altered position of the forelimbs, and show variable anteriorizing homeotic transformations of cervicothoracic vertrebrae C6 through T1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik C A 8: 36,512,212 T323K probably benign Het
Bcl2a1d C T 9: 88,731,653 V23I probably benign Het
Birc2 A T 9: 7,818,935 L552M probably benign Het
Chst3 A T 10: 60,186,068 L319Q probably damaging Het
Col19a1 T C 1: 24,525,645 T296A unknown Het
Colgalt2 A T 1: 152,489,887 I313L probably benign Het
Dclre1b A C 3: 103,804,084 probably null Het
Ezr A T 17: 6,754,797 I94N probably damaging Het
Fry T G 5: 150,310,360 I99S probably damaging Het
Hba-x T C 11: 32,278,000 Y155H probably damaging Het
Herc3 T A 6: 58,916,516 V921D probably damaging Het
Icam5 A G 9: 21,037,739 T796A probably damaging Het
Igkv8-26 G A 6: 70,193,246 V7I probably benign Het
Ikzf1 C T 11: 11,754,166 T194M probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Olfr1447 T C 19: 12,901,004 M259V probably benign Het
Padi2 A G 4: 140,906,546 Y38C probably damaging Het
Pilra A T 5: 137,823,552 S274T probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Rreb1 T C 13: 37,893,893 V27A possibly damaging Het
Rxfp1 A G 3: 79,652,272 V414A probably benign Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Sirt1 T A 10: 63,337,098 probably null Het
Slc5a6 A G 5: 31,037,718 S512P probably benign Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sp7 T A 15: 102,358,892 T160S possibly damaging Het
Tcte1 A G 17: 45,539,691 I298V probably benign Het
Ttc4 G A 4: 106,665,683 T346I probably damaging Het
Ttn T C 2: 76,713,712 T32977A probably damaging Het
Yeats2 A G 16: 20,156,935 K114E possibly damaging Het
Zdbf2 T C 1: 63,302,861 V133A possibly damaging Het
Other mutations in Hoxb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Hoxb5 APN 11 96303992 missense possibly damaging 0.74
IGL02608:Hoxb5 APN 11 96305143 unclassified probably benign
IGL02876:Hoxb5 APN 11 96303768 missense probably damaging 0.98
R0233:Hoxb5 UTSW 11 96305027 missense probably benign 0.04
R0233:Hoxb5 UTSW 11 96305027 missense probably benign 0.04
R0536:Hoxb5 UTSW 11 96304028 missense possibly damaging 0.86
R1962:Hoxb5 UTSW 11 96304092 missense probably benign 0.19
R3769:Hoxb5 UTSW 11 96303969 missense possibly damaging 0.59
R4457:Hoxb5 UTSW 11 96303720 missense probably damaging 1.00
R6515:Hoxb5 UTSW 11 96305082 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGATCTCAGCGTCAACCG -3'
(R):5'- GGGATCTATATTTGAGGCAAAGC -3'

Sequencing Primer
(F):5'- TCCTCCAGCCACTTTGGGG -3'
(R):5'- AGCCAAGCTTTGCTCGC -3'
Posted On2015-06-12