Incidental Mutation 'R4250:Ezr'
ID321321
Institutional Source Beutler Lab
Gene Symbol Ezr
Ensembl Gene ENSMUSG00000052397
Gene Nameezrin
Synonymscytovillin, Vil2, ezrin, p81
MMRRC Submission 041066-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4250 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location6738041-6782784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 6754797 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 94 (I94N)
Ref Sequence ENSEMBL: ENSMUSP00000063734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064234]
Predicted Effect probably damaging
Transcript: ENSMUST00000064234
AA Change: I94N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063734
Gene: ENSMUSG00000052397
AA Change: I94N

DomainStartEndE-ValueType
B41 1 206 7.74e-79 SMART
FERM_C 210 299 1.34e-35 SMART
Pfam:ERM 338 586 2.3e-73 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytoplasmic peripheral membrane protein encoded by this gene functions as a protein-tyrosine kinase substrate in microvilli. As a member of the ERM protein family, this protein serves as an intermediate between the plasma membrane and the actin cytoskeleton. This protein plays a key role in cell surface structure adhesion, migration and organization, and it has been implicated in various human cancers. A pseudogene located on chromosome 3 has been identified for this gene. Alternatively spliced variants have also been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display postnatal lethality with abnormal intestinal villi morphology. Mice homozygous for a knock-down allele exhibit growth retardation, partial postnatal lethality, achlorhydria, and abnormal gastric parietal cell morphology and response to histamine stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik C A 8: 36,512,212 T323K probably benign Het
Bcl2a1d C T 9: 88,731,653 V23I probably benign Het
Birc2 A T 9: 7,818,935 L552M probably benign Het
Chst3 A T 10: 60,186,068 L319Q probably damaging Het
Col19a1 T C 1: 24,525,645 T296A unknown Het
Colgalt2 A T 1: 152,489,887 I313L probably benign Het
Dclre1b A C 3: 103,804,084 probably null Het
Fry T G 5: 150,310,360 I99S probably damaging Het
Hba-x T C 11: 32,278,000 Y155H probably damaging Het
Herc3 T A 6: 58,916,516 V921D probably damaging Het
Hoxb5 T C 11: 96,304,028 S139P possibly damaging Het
Icam5 A G 9: 21,037,739 T796A probably damaging Het
Igkv8-26 G A 6: 70,193,246 V7I probably benign Het
Ikzf1 C T 11: 11,754,166 T194M probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Olfr1447 T C 19: 12,901,004 M259V probably benign Het
Padi2 A G 4: 140,906,546 Y38C probably damaging Het
Pilra A T 5: 137,823,552 S274T probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Rreb1 T C 13: 37,893,893 V27A possibly damaging Het
Rxfp1 A G 3: 79,652,272 V414A probably benign Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Sirt1 T A 10: 63,337,098 probably null Het
Slc5a6 A G 5: 31,037,718 S512P probably benign Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sp7 T A 15: 102,358,892 T160S possibly damaging Het
Tcte1 A G 17: 45,539,691 I298V probably benign Het
Ttc4 G A 4: 106,665,683 T346I probably damaging Het
Ttn T C 2: 76,713,712 T32977A probably damaging Het
Yeats2 A G 16: 20,156,935 K114E possibly damaging Het
Zdbf2 T C 1: 63,302,861 V133A possibly damaging Het
Other mutations in Ezr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Ezr APN 17 6742489 unclassified probably benign
IGL02871:Ezr APN 17 6742390 nonsense probably null
R0020:Ezr UTSW 17 6742727 missense probably damaging 1.00
R0020:Ezr UTSW 17 6742727 missense probably damaging 1.00
R0277:Ezr UTSW 17 6754765 nonsense probably null
R0323:Ezr UTSW 17 6754765 nonsense probably null
R0930:Ezr UTSW 17 6753999 nonsense probably null
R1497:Ezr UTSW 17 6742708 missense probably benign 0.07
R1669:Ezr UTSW 17 6739313 missense probably damaging 1.00
R1801:Ezr UTSW 17 6742372 missense possibly damaging 0.62
R2078:Ezr UTSW 17 6782642 start codon destroyed probably null 0.23
R4448:Ezr UTSW 17 6753074 missense probably benign 0.01
R4610:Ezr UTSW 17 6739722 missense possibly damaging 0.71
R4691:Ezr UTSW 17 6759562 missense probably benign
R4736:Ezr UTSW 17 6741576 missense probably benign 0.42
R5327:Ezr UTSW 17 6753049 missense probably damaging 1.00
R6564:Ezr UTSW 17 6742847 missense probably damaging 0.99
R7863:Ezr UTSW 17 6741464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACAGAATCACCTGCTCCC -3'
(R):5'- GTGATAATGGGATGACAACTCTGAG -3'

Sequencing Primer
(F):5'- AGACAGGGGCTTGTGCTC -3'
(R):5'- ACAACTCTGAGTCACTGGTG -3'
Posted On2015-06-12